\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507148577:

Variant ID: vg0507148577 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7148577
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAGCAGGCGAAGCAGGAGCCGCTCGTTGGTCAACACCGCACGCACGCACTAGCTCACCGGACTGCTATCGCCGCCTTCGTCGTCGTTCCGCTCGTTC[G/A]
TCACCGGAGAGAAGAGATTTGGGAGCTAGGGTTTTGCCCCTCTCTTCCGGTCGGCACTTCATCCATCATGGGGACAATCGGAGCCGTCCATTAGATCGAA

Reverse complement sequence

TTCGATCTAATGGACGGCTCCGATTGTCCCCATGATGGATGAAGTGCCGACCGGAAGAGAGGGGCAAAACCCTAGCTCCCAAATCTCTTCTCTCCGGTGA[C/T]
GAACGAGCGGAACGACGACGAAGGCGGCGATAGCAGTCCGGTGAGCTAGTGCGTGCGTGCGGTGTTGACCAACGAGCGGCTCCTGCTTCGCCTGCTGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.90% 0.21% 0.42% NA
All Indica  2759 41.40% 57.80% 0.29% 0.54% NA
All Japonica  1512 95.80% 3.90% 0.00% 0.26% NA
Aus  269 23.40% 76.20% 0.37% 0.00% NA
Indica I  595 18.30% 81.70% 0.00% 0.00% NA
Indica II  465 73.80% 25.20% 0.43% 0.65% NA
Indica III  913 42.40% 56.50% 0.55% 0.55% NA
Indica Intermediate  786 38.40% 60.60% 0.13% 0.89% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.20% 0.00% 0.60% NA
Japonica Intermediate  241 85.50% 14.10% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507148577 G -> DEL N N silent_mutation Average:71.289; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0507148577 G -> A LOC_Os05g12450.1 upstream_gene_variant ; 3754.0bp to feature; MODIFIER silent_mutation Average:71.289; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0507148577 G -> A LOC_Os05g12430.1 downstream_gene_variant ; 1950.0bp to feature; MODIFIER silent_mutation Average:71.289; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0507148577 G -> A LOC_Os05g12440.1 downstream_gene_variant ; 1085.0bp to feature; MODIFIER silent_mutation Average:71.289; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0507148577 G -> A LOC_Os05g12430-LOC_Os05g12440 intergenic_region ; MODIFIER silent_mutation Average:71.289; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507148577 NA 1.88E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 1.96E-06 7.21E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 7.17E-14 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 8.54E-08 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 1.38E-07 1.13E-11 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 6.46E-28 3.15E-28 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 1.17E-41 7.57E-72 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 6.40E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 3.66E-13 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 1.03E-09 7.19E-31 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 8.39E-12 2.15E-22 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 1.09E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 6.20E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 1.30E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 1.25E-09 NA mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 6.47E-10 1.17E-14 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 8.13E-35 1.98E-37 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 1.32E-52 1.81E-92 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 1.26E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 6.85E-07 2.18E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148577 NA 1.52E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251