\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507141002:

Variant ID: vg0507141002 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7141002
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCAGTGACAATCATGATGAAATCATCTTCAGGAGTTGTCAAATTCGTCTTCCCTCCAAGGCAAACATTTTGTTTTGGCGGTTTCATCTTTCTCACC[G/A]
ACAACTTCTGCAAGCATTTGTTGACGGTTGTTAGCGATCAGTTTCAACCGTCAATATTACCATAATAGACGAGAACTAGTTATGCTTGCAATGCATATTT

Reverse complement sequence

AAATATGCATTGCAAGCATAACTAGTTCTCGTCTATTATGGTAATATTGACGGTTGAAACTGATCGCTAACAACCGTCAACAAATGCTTGCAGAAGTTGT[C/T]
GGTGAGAAAGATGAAACCGCCAAAACAAAATGTTTGCCTTGGAGGGAAGACGAATTTGACAACTCCTGAAGATGATTTCATCATGATTGTCACTGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 40.50% 0.21% 0.72% NA
All Indica  2759 40.00% 58.80% 0.25% 0.91% NA
All Japonica  1512 95.70% 3.90% 0.07% 0.33% NA
Aus  269 22.30% 77.30% 0.37% 0.00% NA
Indica I  595 17.80% 82.00% 0.17% 0.00% NA
Indica II  465 73.30% 25.20% 0.43% 1.08% NA
Indica III  913 40.40% 58.30% 0.11% 1.20% NA
Indica Intermediate  786 36.60% 61.80% 0.38% 1.15% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 95.00% 4.20% 0.20% 0.60% NA
Japonica Intermediate  241 85.50% 14.10% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 70.00% 26.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507141002 G -> DEL N N silent_mutation Average:32.929; most accessible tissue: Callus, score: 58.893 N N N N
vg0507141002 G -> A LOC_Os05g12410.1 upstream_gene_variant ; 3318.0bp to feature; MODIFIER silent_mutation Average:32.929; most accessible tissue: Callus, score: 58.893 N N N N
vg0507141002 G -> A LOC_Os05g12430.1 upstream_gene_variant ; 4545.0bp to feature; MODIFIER silent_mutation Average:32.929; most accessible tissue: Callus, score: 58.893 N N N N
vg0507141002 G -> A LOC_Os05g12420.1 intron_variant ; MODIFIER silent_mutation Average:32.929; most accessible tissue: Callus, score: 58.893 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507141002 NA 6.31E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 7.50E-06 2.23E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 4.15E-07 9.52E-10 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 NA 4.87E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 2.41E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 2.50E-08 2.33E-12 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 7.72E-32 3.41E-30 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 2.94E-42 5.02E-73 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 NA 2.37E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 4.22E-11 1.29E-32 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 1.12E-12 3.59E-23 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 NA 1.36E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 NA 1.03E-10 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 NA 9.92E-08 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 2.86E-09 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 8.48E-10 1.42E-14 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 2.06E-37 6.11E-39 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 6.70E-53 1.40E-93 mr1593_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 NA 2.35E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507141002 2.84E-06 9.99E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251