Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507139709:

Variant ID: vg0507139709 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7139709
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CCCCTCGCGAGTGTGTTCGTATCAGGATTCCTATATGTAAATAATCTTAGTTAAGTTAAGGTAAAACTCTATTAGTTTCTTCGAGCAACGGTTCACTCCT[G/A]
GTCTACCAAGGGACTCCAGCATGTATCTCTATGATGTACCCGAACGTGAAGGATTAAGAAAGACGGACATGATTGTCACCACATGTTGGCTGTTGCCTAC

Reverse complement sequence

GTAGGCAACAGCCAACATGTGGTGACAATCATGTCCGTCTTTCTTAATCCTTCACGTTCGGGTACATCATAGAGATACATGCTGGAGTCCCTTGGTAGAC[C/T]
AGGAGTGAACCGTTGCTCGAAGAAACTAATAGAGTTTTACCTTAACTTAACTAAGATTATTTACATATAGGAATCCTGATACGAACACACTCGCGAGGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	3.80%	0.00%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	46.10%	53.90%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507139709	G -> A	LOC_Os05g12400.1	upstream_gene_variant ; 4159.0bp to feature; MODIFIER	silent_mutation	Average:53.235; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N
vg0507139709	G -> A	LOC_Os05g12410.1	upstream_gene_variant ; 2025.0bp to feature; MODIFIER	silent_mutation	Average:53.235; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N
vg0507139709	G -> A	LOC_Os05g12420.1	intron_variant ; MODIFIER	silent_mutation	Average:53.235; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507139709	NA	2.86E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	2.16E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	4.94E-37	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	6.13E-43	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	1.27E-06	NA	mr1593	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	9.19E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	2.53E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	2.61E-06	NA	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	2.25E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	2.40E-28	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709	NA	1.24E-16	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251