\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507139709:

Variant ID: vg0507139709 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7139709
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTCGCGAGTGTGTTCGTATCAGGATTCCTATATGTAAATAATCTTAGTTAAGTTAAGGTAAAACTCTATTAGTTTCTTCGAGCAACGGTTCACTCCT[G/A]
GTCTACCAAGGGACTCCAGCATGTATCTCTATGATGTACCCGAACGTGAAGGATTAAGAAAGACGGACATGATTGTCACCACATGTTGGCTGTTGCCTAC

Reverse complement sequence

GTAGGCAACAGCCAACATGTGGTGACAATCATGTCCGTCTTTCTTAATCCTTCACGTTCGGGTACATCATAGAGATACATGCTGGAGTCCCTTGGTAGAC[C/T]
AGGAGTGAACCGTTGCTCGAAGAAACTAATAGAGTTTTACCTTAACTTAACTAAGATTATTTACATATAGGAATCCTGATACGAACACACTCGCGAGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.20% 3.80% 0.00% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 46.10% 53.90% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507139709 G -> A LOC_Os05g12400.1 upstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:53.235; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0507139709 G -> A LOC_Os05g12410.1 upstream_gene_variant ; 2025.0bp to feature; MODIFIER silent_mutation Average:53.235; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0507139709 G -> A LOC_Os05g12420.1 intron_variant ; MODIFIER silent_mutation Average:53.235; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507139709 NA 2.86E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 2.16E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 4.94E-37 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 6.13E-43 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 1.27E-06 NA mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 9.19E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 2.53E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 2.61E-06 NA mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 2.25E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 2.40E-28 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507139709 NA 1.24E-16 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251