\
| Variant ID: vg0507139485 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7139485 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, others allele: 0.00, population size: 195. )
TAGGTATAAAGCTAGTTATTCCGGATCGTGGTTCTATGATTGCTCGGTGTGACGGATCGGAGTCCGGGAGGCTTCGGATTGTTCTCACCCTCACCACTTC[A/G]
TCGCATCCGACCTTGGTAGGTATAAAGATAGTTATCCTCTTGCTGCTCGTAGCTAGTTACCCTCTTGTGTTTCGGTTTACGCCGGCACTCTGTCTTGAAC
GTTCAAGACAGAGTGCCGGCGTAAACCGAAACACAAGAGGGTAACTAGCTACGAGCAGCAAGAGGATAACTATCTTTATACCTACCAAGGTCGGATGCGA[T/C]
GAAGTGGTGAGGGTGAGAACAATCCGAAGCCTCCCGGACTCCGATCCGTCACACCGAGCAATCATAGAACCACGATCCGGAATAACTAGCTTTATACCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 40.80% | 0.06% | 0.61% | NA |
| All Indica | 2759 | 40.30% | 58.90% | 0.04% | 0.80% | NA |
| All Japonica | 1512 | 95.80% | 3.90% | 0.07% | 0.26% | NA |
| Aus | 269 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 18.00% | 82.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.00% | 25.20% | 0.00% | 0.86% | NA |
| Indica III | 913 | 40.50% | 58.30% | 0.11% | 1.10% | NA |
| Indica Intermediate | 786 | 36.90% | 62.10% | 0.00% | 1.02% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.20% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 30.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507139485 | A -> DEL | LOC_Os05g12420.1 | N | frameshift_variant | Average:56.699; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0507139485 | A -> G | LOC_Os05g12420.1 | synonymous_variant ; p.Ser136Ser; LOW | synonymous_codon | Average:56.699; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507139485 | NA | 8.80E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 3.32E-06 | 2.50E-11 | mr1195 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 2.43E-07 | 4.87E-10 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 3.23E-12 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 2.77E-07 | NA | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 6.14E-08 | 7.12E-12 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 1.03E-35 | 7.59E-30 | mr1593 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 1.21E-43 | 1.02E-75 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 2.84E-12 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 3.22E-11 | 1.26E-32 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 3.87E-12 | 3.32E-23 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 2.78E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 7.18E-10 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 2.04E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 1.20E-09 | NA | mr1531_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 6.39E-10 | 1.26E-14 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 2.02E-41 | 2.19E-38 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 1.13E-51 | 1.87E-94 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 2.69E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | 1.06E-06 | 3.22E-11 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507139485 | NA | 1.39E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |