\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507128411:

Variant ID: vg0507128411 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7128411
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACTTGAAAGTTTTCGAATCTCAAAGTTGAAAGTTTTCGAATCTCGAGTTGAAAGTTTTCAAATCTCAAATTGAAAGTTTTCAAATTTTTCAAATCTG[G/A]
ACTTAAAAGTTTTTGAATCTAAGTTGACAGTTTTGAAAATTTGACTTTAAAGTTTAAAATTTAAATCGAAAATTTTCAAATCTAACTTAAAAAATTTTCA

Reverse complement sequence

TGAAAATTTTTTAAGTTAGATTTGAAAATTTTCGATTTAAATTTTAAACTTTAAAGTCAAATTTTCAAAACTGTCAACTTAGATTCAAAAACTTTTAAGT[C/T]
CAGATTTGAAAAATTTGAAAACTTTCAATTTGAGATTTGAAAACTTTCAACTCGAGATTCGAAAACTTTCAACTTTGAGATTCGAAAACTTTCAAGTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.40% 0.34% 0.38% NA
All Indica  2759 59.90% 39.10% 0.47% 0.51% NA
All Japonica  1512 60.30% 39.40% 0.20% 0.20% NA
Aus  269 27.50% 72.50% 0.00% 0.00% NA
Indica I  595 83.50% 16.50% 0.00% 0.00% NA
Indica II  465 26.50% 72.00% 1.08% 0.43% NA
Indica III  913 58.60% 40.40% 0.22% 0.77% NA
Indica Intermediate  786 63.50% 35.10% 0.76% 0.64% NA
Temperate Japonica  767 91.50% 8.30% 0.13% 0.00% NA
Tropical Japonica  504 13.50% 85.70% 0.40% 0.40% NA
Japonica Intermediate  241 58.50% 41.10% 0.00% 0.41% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507128411 G -> DEL N N silent_mutation Average:31.511; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0507128411 G -> A LOC_Os05g12380.1 downstream_gene_variant ; 1259.0bp to feature; MODIFIER silent_mutation Average:31.511; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0507128411 G -> A LOC_Os05g12390.1 downstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:31.511; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0507128411 G -> A LOC_Os05g12380-LOC_Os05g12390 intergenic_region ; MODIFIER silent_mutation Average:31.511; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507128411 NA 7.86E-17 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507128411 NA 5.34E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507128411 2.34E-09 2.09E-10 mr1195 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 4.66E-06 9.42E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 2.14E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 7.16E-07 1.45E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 1.28E-06 2.31E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 4.14E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 3.29E-57 1.12E-109 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 2.96E-35 3.43E-64 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 1.49E-16 4.67E-39 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 4.92E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 4.31E-06 NA mr1807 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 7.14E-12 NA mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 4.60E-10 1.01E-21 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 8.18E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 5.73E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 2.57E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 7.68E-07 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 8.25E-07 6.88E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 1.10E-66 1.69E-129 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 2.68E-42 6.66E-78 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 4.21E-24 9.08E-61 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 NA 3.18E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 1.53E-10 5.80E-14 mr1807_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507128411 2.76E-08 5.02E-13 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251