\
| Variant ID: vg0507120963 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7120963 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGCTGAATTCCAAGACTCGGATTCCTCGTCTCCCCTCTTTAACCTGAAACTAAGATGTGTTTCCTGCGACCCTTCTCAGAACCTGATTAGTTCCCACGCA[G/A]
AAACTTTTTATTCCGTCATATTAAATGTTTAGACACATGCATAGAGTATTAAATATAGAAAAAAACTAATCACGCTGATTGCGTGTAAATTGCGAGACGA
TCGTCTCGCAATTTACACGCAATCAGCGTGATTAGTTTTTTTCTATATTTAATACTCTATGCATGTGTCTAAACATTTAATATGACGGAATAAAAAGTTT[C/T]
TGCGTGGGAACTAATCAGGTTCTGAGAAGGGTCGCAGGAAACACATCTTAGTTTCAGGTTAAAGAGGGGAGACGAGGAATCCGAGTCTTGGAATTCAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 18.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 43.90% | 56.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507120963 | G -> A | LOC_Os05g12380.1 | upstream_gene_variant ; 2907.0bp to feature; MODIFIER | silent_mutation | Average:54.093; most accessible tissue: Callus, score: 70.192 | N | N | N | N |
| vg0507120963 | G -> A | LOC_Os05g12370-LOC_Os05g12380 | intergenic_region ; MODIFIER | silent_mutation | Average:54.093; most accessible tissue: Callus, score: 70.192 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507120963 | NA | 4.49E-43 | Grain_thickness | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507120963 | NA | 7.10E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507120963 | NA | 1.86E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 6.25E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | 2.08E-07 | 1.67E-11 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | 4.91E-10 | 6.50E-28 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 4.34E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 2.91E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 1.92E-23 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 1.07E-11 | mr1879 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 8.95E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | 9.39E-09 | 3.18E-12 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | 4.08E-15 | 4.77E-42 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507120963 | NA | 1.35E-28 | mr1789_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |