\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507108805:

Variant ID: vg0507108805 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7108805
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCAGAATGGTGTAGCGGAACGTAAACATCGTCATCTTCTTGAGACTGCTCGTGCTCTTATGATTGCTTCTTCTGTTCCTCCTCATTTTTGGGCTGAGG[T/C]
TGTTTCCACTGCTAATTACTTGATCAACATCCAACCTTCCTCTGCTCTACAGGGTGGGATTCCTATTGAGCATCTTTGTGGCCAGCCTCCTGATTATTCT

Reverse complement sequence

AGAATAATCAGGAGGCTGGCCACAAAGATGCTCAATAGGAATCCCACCCTGTAGAGCAGAGGAAGGTTGGATGTTGATCAAGTAATTAGCAGTGGAAACA[A/G]
CCTCAGCCCAAAAATGAGGAGGAACAGAAGAAGCAATCATAAGAGCACGAGCAGTCTCAAGAAGATGACGATGTTTACGTTCCGCTACACCATTCTGAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.50% 1.70% 23.42% 55.44% NA
All Indica  2759 1.50% 2.00% 22.04% 74.41% NA
All Japonica  1512 56.70% 0.90% 18.52% 23.88% NA
Aus  269 0.70% 2.20% 66.54% 30.48% NA
Indica I  595 1.80% 1.20% 18.15% 78.82% NA
Indica II  465 2.80% 2.60% 26.02% 68.60% NA
Indica III  913 0.90% 2.60% 20.15% 76.34% NA
Indica Intermediate  786 1.30% 1.70% 24.81% 72.26% NA
Temperate Japonica  767 91.30% 0.00% 2.48% 6.26% NA
Tropical Japonica  504 9.70% 2.00% 42.06% 46.23% NA
Japonica Intermediate  241 45.20% 1.20% 20.33% 33.20% NA
VI/Aromatic  96 0.00% 1.00% 14.58% 84.38% NA
Intermediate  90 21.10% 2.20% 28.89% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507108805 T -> DEL LOC_Os05g12360.1 N splice_donor_variant Average:38.689; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0507108805 T -> C LOC_Os05g12360.1 splice_donor_variant&intron_variant ; HIGH splice_donor_variant Average:38.689; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507108805 NA 5.52E-40 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507108805 NA 4.46E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507108805 NA 3.64E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 4.23E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.83E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.97E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 2.28E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.37E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 5.43E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 3.78E-07 3.37E-12 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 3.57E-08 4.18E-26 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 2.32E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 9.07E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 2.50E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 4.69E-26 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.14E-07 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.15E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 9.79E-50 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 3.16E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.71E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 3.02E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.01E-07 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 6.11E-09 2.65E-13 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 2.22E-13 1.35E-40 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.15E-16 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 3.27E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 1.86E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 NA 6.43E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 9.86E-07 NA mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507108805 1.63E-06 NA mr1968_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251