\
| Variant ID: vg0507073939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7073939 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAAGTAAATTGCGTCTACAGTACACAAACTTAGTAAGTGGGTACGATCTAGTGCAAGAATTTGAAAAATGATTATATAGATGTAACAACTTGGTTAGT[A/G]
CGTGCATTTTGGTTAAAATATCTCTCTTCCACACCATACTTTTTCAGCTATATAAAGAAAAAGCAGCCAGTTAGGTCATCTTGAGTTCCGAATAAGGTTT
AAACCTTATTCGGAACTCAAGATGACCTAACTGGCTGCTTTTTCTTTATATAGCTGAAAAAGTATGGTGTGGAAGAGAGATATTTTAACCAAAATGCACG[T/C]
ACTAACCAAGTTGTTACATCTATATAATCATTTTTCAAATTCTTGCACTAGATCGTACCCACTTACTAAGTTTGTGTACTGTAGACGCAATTTACTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 18.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 44.00% | 56.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 9.90% | 90.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507073939 | A -> G | LOC_Os05g12310.1 | downstream_gene_variant ; 2545.0bp to feature; MODIFIER | silent_mutation | Average:26.448; most accessible tissue: Zhenshan97 flower, score: 35.75 | N | N | N | N |
| vg0507073939 | A -> G | LOC_Os05g12300-LOC_Os05g12310 | intergenic_region ; MODIFIER | silent_mutation | Average:26.448; most accessible tissue: Zhenshan97 flower, score: 35.75 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507073939 | NA | 3.50E-40 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507073939 | NA | 7.10E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507073939 | NA | 2.50E-17 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 1.08E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 1.78E-17 | mr1401 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 1.86E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 6.25E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 3.86E-21 | mr1584 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | 1.82E-08 | 6.59E-12 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | 4.91E-10 | 6.50E-28 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 4.34E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 6.10E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 8.95E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | 2.89E-08 | 1.18E-12 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | 4.08E-15 | 4.77E-42 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 5.18E-29 | mr1789_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | NA | 5.20E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073939 | 1.49E-07 | NA | mr1968_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |