\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507062592:

Variant ID: vg0507062592 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7062592
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTCGACGGCACCGGCGGCGGCTTGACGACGGCCGCTCCGTGCCCCTCCTCGCCAGATCCGGCCTTAAGGTCGCCGGATCTGGCCTTGGGAGGCGGTGG[C/T]
GGCGGTGGCGGCTTGAAGGCGGCAGCAGCAGATCGAAGGCTGCGGCAGCGGCTCGACTGCGGGAGCAGCAGCTCGAAGGCGGCGGCGGCGGCTCGACTGC

Reverse complement sequence

GCAGTCGAGCCGCCGCCGCCGCCTTCGAGCTGCTGCTCCCGCAGTCGAGCCGCTGCCGCAGCCTTCGATCTGCTGCTGCCGCCTTCAAGCCGCCACCGCC[G/A]
CCACCGCCTCCCAAGGCCAGATCCGGCGACCTTAAGGCCGGATCTGGCGAGGAGGGGCACGGAGCGGCCGTCGTCAAGCCGCCGCCGGTGCCGTCGAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 4.30% 0.00% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 48.70% 51.30% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507062592 C -> T LOC_Os05g12300.1 missense_variant ; p.Arg72Trp; MODERATE nonsynonymous_codon ; R72W Average:88.896; most accessible tissue: Zhenshan97 panicle, score: 95.548 unknown unknown DELETERIOUS 0.00
vg0507062592 C -> T LOC_Os05g12300.2 missense_variant ; p.Arg72Trp; MODERATE nonsynonymous_codon ; R72W Average:88.896; most accessible tissue: Zhenshan97 panicle, score: 95.548 unknown unknown DELETERIOUS 0.00
vg0507062592 C -> T LOC_Os05g12300.3 missense_variant ; p.Arg72Trp; MODERATE nonsynonymous_codon ; R72W Average:88.896; most accessible tissue: Zhenshan97 panicle, score: 95.548 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507062592 C T -0.01 -0.02 -0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507062592 NA 1.49E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507062592 NA 8.98E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507062592 NA 8.61E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507062592 2.82E-09 NA mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507062592 2.39E-08 NA mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251