\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507044489:

Variant ID: vg0507044489 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7044489
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAGAGCGGTAGGAACTGACAGGTGGGACCCACTGATTATTTTTTTAAAAAAATGCTGACTAGACTGCCACGTGGACCCAAAACCACTCCGGATTGAGT[C/T]
GGAGGTGTTATTTGTCCAGTTTTAATAGTTGAGGGTGTAGAATATCTGGTTTTCAAGTTCGGGGGTGTAATTCAGTCGACCTCGATAGTTCGGGGGGTAA

Reverse complement sequence

TTACCCCCCGAACTATCGAGGTCGACTGAATTACACCCCCGAACTTGAAAACCAGATATTCTACACCCTCAACTATTAAAACTGGACAAATAACACCTCC[G/A]
ACTCAATCCGGAGTGGTTTTGGGTCCACGTGGCAGTCTAGTCAGCATTTTTTTAAAAAAATAATCAGTGGGTCCCACCTGTCAGTTCCTACCGCTCTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 29.40% 0.15% 0.74% NA
All Indica  2759 51.30% 47.50% 0.22% 1.05% NA
All Japonica  1512 99.50% 0.30% 0.00% 0.20% NA
Aus  269 77.30% 22.70% 0.00% 0.00% NA
Indica I  595 27.90% 71.90% 0.17% 0.00% NA
Indica II  465 74.80% 24.50% 0.22% 0.43% NA
Indica III  913 56.20% 41.80% 0.22% 1.75% NA
Indica Intermediate  786 49.20% 49.10% 0.25% 1.40% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 15.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507044489 C -> T LOC_Os05g12270.1 downstream_gene_variant ; 4130.0bp to feature; MODIFIER silent_mutation Average:92.827; most accessible tissue: Zhenshan97 panicle, score: 97.62 N N N N
vg0507044489 C -> T LOC_Os05g12270-LOC_Os05g12280 intergenic_region ; MODIFIER silent_mutation Average:92.827; most accessible tissue: Zhenshan97 panicle, score: 97.62 N N N N
vg0507044489 C -> DEL N N silent_mutation Average:92.827; most accessible tissue: Zhenshan97 panicle, score: 97.62 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507044489 C T -0.03 -0.03 -0.03 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507044489 NA 7.51E-13 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 1.50E-10 1.58E-23 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 1.86E-10 6.09E-15 mr1531 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 4.62E-21 1.80E-28 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 9.83E-17 1.15E-32 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 NA 8.75E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 NA 4.21E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 NA 8.34E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 4.56E-09 3.18E-26 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 1.43E-07 5.64E-14 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 NA 8.76E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 NA 5.61E-09 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 3.28E-25 3.28E-35 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507044489 2.11E-19 2.67E-43 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251