\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506999903:

Variant ID: vg0506999903 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6999903
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.33, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTCTACCTTCAGAGACAACCATGATGATCTCTTTGAATGTACATTTAGCTATCCTATTTTAGTTGAATAAAACTAATTAACTTCACATAGAAATATAT[G/T]
AATGCTATATTTATCCAAAAAAAGAAAACACACCTATTTAGGCAACAAAGTAGTTGTTTGCACGGTAGTAACATGACCTGAAAGAAGGAGAGCAGCACAT

Reverse complement sequence

ATGTGCTGCTCTCCTTCTTTCAGGTCATGTTACTACCGTGCAAACAACTACTTTGTTGCCTAAATAGGTGTGTTTTCTTTTTTTGGATAAATATAGCATT[C/A]
ATATATTTCTATGTGAAGTTAATTAGTTTTATTCAACTAAAATAGGATAGCTAAATGTACATTCAAAGAGATCATCATGGTTGTCTCTGAAGGTAGAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 43.00% 0.04% 0.11% NA
All Indica  2759 86.70% 13.10% 0.04% 0.18% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.00% 0.17% NA
Indica II  465 78.90% 20.60% 0.00% 0.43% NA
Indica III  913 84.90% 15.00% 0.00% 0.11% NA
Indica Intermediate  786 86.30% 13.50% 0.13% 0.13% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506999903 G -> T LOC_Os05g12220.1 upstream_gene_variant ; 1872.0bp to feature; MODIFIER silent_mutation Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0506999903 G -> T LOC_Os05g12230.1 downstream_gene_variant ; 34.0bp to feature; MODIFIER silent_mutation Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0506999903 G -> T LOC_Os05g12240.1 downstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0506999903 G -> T LOC_Os05g12220-LOC_Os05g12230 intergenic_region ; MODIFIER silent_mutation Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0506999903 G -> DEL N N silent_mutation Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506999903 6.12E-12 1.68E-40 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 9.75E-09 1.52E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 6.53E-07 9.16E-13 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 NA 1.07E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 NA 6.97E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 1.08E-11 1.69E-43 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 3.27E-10 7.07E-16 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 4.16E-09 3.52E-48 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 NA 5.47E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 NA 8.19E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 7.34E-14 4.32E-43 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 3.53E-09 5.43E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 9.09E-11 4.28E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 5.55E-07 5.77E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 NA 2.32E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 6.18E-18 1.15E-56 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 1.12E-12 1.86E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 3.08E-08 9.61E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506999903 3.23E-06 6.26E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251