\
| Variant ID: vg0506999903 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6999903 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.33, others allele: 0.00, population size: 241. )
CTCTCTACCTTCAGAGACAACCATGATGATCTCTTTGAATGTACATTTAGCTATCCTATTTTAGTTGAATAAAACTAATTAACTTCACATAGAAATATAT[G/T]
AATGCTATATTTATCCAAAAAAAGAAAACACACCTATTTAGGCAACAAAGTAGTTGTTTGCACGGTAGTAACATGACCTGAAAGAAGGAGAGCAGCACAT
ATGTGCTGCTCTCCTTCTTTCAGGTCATGTTACTACCGTGCAAACAACTACTTTGTTGCCTAAATAGGTGTGTTTTCTTTTTTTGGATAAATATAGCATT[C/A]
ATATATTTCTATGTGAAGTTAATTAGTTTTATTCAACTAAAATAGGATAGCTAAATGTACATTCAAAGAGATCATCATGGTTGTCTCTGAAGGTAGAGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 43.00% | 0.04% | 0.11% | NA |
| All Indica | 2759 | 86.70% | 13.10% | 0.04% | 0.18% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 3.90% | 0.00% | 0.17% | NA |
| Indica II | 465 | 78.90% | 20.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 84.90% | 15.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 86.30% | 13.50% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 62.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506999903 | G -> T | LOC_Os05g12220.1 | upstream_gene_variant ; 1872.0bp to feature; MODIFIER | silent_mutation | Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0506999903 | G -> T | LOC_Os05g12230.1 | downstream_gene_variant ; 34.0bp to feature; MODIFIER | silent_mutation | Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0506999903 | G -> T | LOC_Os05g12240.1 | downstream_gene_variant ; 4165.0bp to feature; MODIFIER | silent_mutation | Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0506999903 | G -> T | LOC_Os05g12220-LOC_Os05g12230 | intergenic_region ; MODIFIER | silent_mutation | Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0506999903 | G -> DEL | N | N | silent_mutation | Average:41.828; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506999903 | 6.12E-12 | 1.68E-40 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 9.75E-09 | 1.52E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 6.53E-07 | 9.16E-13 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | NA | 1.07E-06 | mr1514 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | NA | 6.97E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 1.08E-11 | 1.69E-43 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 3.27E-10 | 7.07E-16 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 4.16E-09 | 3.52E-48 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | NA | 5.47E-10 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | NA | 8.19E-11 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 7.34E-14 | 4.32E-43 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 3.53E-09 | 5.43E-11 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 9.09E-11 | 4.28E-20 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 5.55E-07 | 5.77E-08 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | NA | 2.32E-07 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 6.18E-18 | 1.15E-56 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 1.12E-12 | 1.86E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 3.08E-08 | 9.61E-40 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506999903 | 3.23E-06 | 6.26E-08 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |