\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506994489:

Variant ID: vg0506994489 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6994489
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, T: 0.38, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTACTTATTTGAAAATTTATTTATTTGGTCCTGGTAACTTTCTGGAGACTGAGATAAGTATTATTTGCTTTTTCGAAGTGGCGGTCCATAAAAAGAT[A/T]
GTATCAACAATATATTGTAAAATGGATAATACAAAATATGATATCACACCTTAAATTTTGGAACTACTATCTTGTTCCTAGGTTCAATAATAATAGCCAA

Reverse complement sequence

TTGGCTATTATTATTGAACCTAGGAACAAGATAGTAGTTCCAAAATTTAAGGTGTGATATCATATTTTGTATTATCCATTTTACAATATATTGTTGATAC[T/A]
ATCTTTTTATGGACCGCCACTTCGAAAAAGCAAATAATACTTATCTCAGTCTCCAGAAAGTTACCAGGACCAAATAAATAAATTTTCAAATAAGTAATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.80% 0.11% 0.00% NA
All Indica  2759 88.60% 11.30% 0.11% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.17% 0.00% NA
Indica II  465 80.20% 19.80% 0.00% 0.00% NA
Indica III  913 89.20% 10.60% 0.22% 0.00% NA
Indica Intermediate  786 87.30% 12.70% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506994489 A -> T LOC_Os05g12210.1 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:23.326; most accessible tissue: Callus, score: 64.659 N N N N
vg0506994489 A -> T LOC_Os05g12220.1 downstream_gene_variant ; 3133.0bp to feature; MODIFIER silent_mutation Average:23.326; most accessible tissue: Callus, score: 64.659 N N N N
vg0506994489 A -> T LOC_Os05g12210-LOC_Os05g12220 intergenic_region ; MODIFIER silent_mutation Average:23.326; most accessible tissue: Callus, score: 64.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506994489 2.87E-08 2.74E-40 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 1.05E-07 4.90E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 1.97E-06 3.09E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 NA 2.96E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 NA 2.07E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 4.59E-09 5.18E-42 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 2.88E-08 2.04E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 1.59E-09 3.26E-49 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 4.70E-07 2.06E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 NA 5.24E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 1.04E-09 1.26E-42 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 2.13E-07 8.17E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 1.50E-10 2.10E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 7.14E-06 5.47E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 NA 9.59E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 4.86E-14 8.62E-56 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 5.32E-10 9.85E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 3.43E-07 2.31E-39 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 NA 4.66E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506994489 1.97E-06 1.97E-06 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251