\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506924589:

Variant ID: vg0506924589 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6924589
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCAGTAAATTTATCAAAATTTTGTGAAAGTTTGCCAAAATTTGGGACAAATTTGAAAGTGGTGTACAAAAGTACCGGAAATTATCCAAGGGTATACTT[G/A]
TCCTTTTTACCCCACATTTAACACCATTAGCAAGAATTAATGGAATATGGGCAAACGGCTATTGCGTTTAAAAAAGTAGGGGGAAAAACGAAAACCCTAA

Reverse complement sequence

TTAGGGTTTTCGTTTTTCCCCCTACTTTTTTAAACGCAATAGCCGTTTGCCCATATTCCATTAATTCTTGCTAATGGTGTTAAATGTGGGGTAAAAAGGA[C/T]
AAGTATACCCTTGGATAATTTCCGGTACTTTTGTACACCACTTTCAAATTTGTCCCAAATTTTGGCAAACTTTCACAAAATTTTGATAAATTTACTGCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 5.60% 0.49% 56.77% NA
All Indica  2759 4.80% 7.80% 0.72% 86.63% NA
All Japonica  1512 95.30% 0.00% 0.07% 4.63% NA
Aus  269 13.40% 16.40% 0.37% 69.89% NA
Indica I  595 4.70% 2.20% 0.34% 92.77% NA
Indica II  465 6.50% 12.90% 1.29% 79.35% NA
Indica III  913 2.00% 9.70% 0.77% 87.51% NA
Indica Intermediate  786 7.30% 6.90% 0.64% 85.24% NA
Temperate Japonica  767 98.40% 0.00% 0.00% 1.56% NA
Tropical Japonica  504 94.60% 0.00% 0.00% 5.36% NA
Japonica Intermediate  241 86.70% 0.00% 0.41% 12.86% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 53.30% 7.80% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506924589 G -> DEL N N silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N
vg0506924589 G -> A LOC_Os05g12090.1 upstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N
vg0506924589 G -> A LOC_Os05g12100.1 upstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N
vg0506924589 G -> A LOC_Os05g12120.1 upstream_gene_variant ; 3127.0bp to feature; MODIFIER silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N
vg0506924589 G -> A LOC_Os05g12094.1 downstream_gene_variant ; 2069.0bp to feature; MODIFIER silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N
vg0506924589 G -> A LOC_Os05g12110.1 downstream_gene_variant ; 1176.0bp to feature; MODIFIER silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N
vg0506924589 G -> A LOC_Os05g12100-LOC_Os05g12110 intergenic_region ; MODIFIER silent_mutation Average:7.453; most accessible tissue: Callus, score: 23.072 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506924589 4.23E-07 NA mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 7.12E-07 2.48E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 9.63E-07 NA mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 1.97E-06 4.96E-10 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 NA 5.08E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 1.62E-06 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 9.78E-06 NA mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 NA 2.65E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 7.25E-08 NA mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506924589 7.03E-07 7.83E-10 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251