\
| Variant ID: vg0506924589 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6924589 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 96. )
TAGCAGTAAATTTATCAAAATTTTGTGAAAGTTTGCCAAAATTTGGGACAAATTTGAAAGTGGTGTACAAAAGTACCGGAAATTATCCAAGGGTATACTT[G/A]
TCCTTTTTACCCCACATTTAACACCATTAGCAAGAATTAATGGAATATGGGCAAACGGCTATTGCGTTTAAAAAAGTAGGGGGAAAAACGAAAACCCTAA
TTAGGGTTTTCGTTTTTCCCCCTACTTTTTTAAACGCAATAGCCGTTTGCCCATATTCCATTAATTCTTGCTAATGGTGTTAAATGTGGGGTAAAAAGGA[C/T]
AAGTATACCCTTGGATAATTTCCGGTACTTTTGTACACCACTTTCAAATTTGTCCCAAATTTTGGCAAACTTTCACAAAATTTTGATAAATTTACTGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 5.60% | 0.49% | 56.77% | NA |
| All Indica | 2759 | 4.80% | 7.80% | 0.72% | 86.63% | NA |
| All Japonica | 1512 | 95.30% | 0.00% | 0.07% | 4.63% | NA |
| Aus | 269 | 13.40% | 16.40% | 0.37% | 69.89% | NA |
| Indica I | 595 | 4.70% | 2.20% | 0.34% | 92.77% | NA |
| Indica II | 465 | 6.50% | 12.90% | 1.29% | 79.35% | NA |
| Indica III | 913 | 2.00% | 9.70% | 0.77% | 87.51% | NA |
| Indica Intermediate | 786 | 7.30% | 6.90% | 0.64% | 85.24% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 0.00% | 5.36% | NA |
| Japonica Intermediate | 241 | 86.70% | 0.00% | 0.41% | 12.86% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 53.30% | 7.80% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506924589 | G -> DEL | N | N | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| vg0506924589 | G -> A | LOC_Os05g12090.1 | upstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| vg0506924589 | G -> A | LOC_Os05g12100.1 | upstream_gene_variant ; 914.0bp to feature; MODIFIER | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| vg0506924589 | G -> A | LOC_Os05g12120.1 | upstream_gene_variant ; 3127.0bp to feature; MODIFIER | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| vg0506924589 | G -> A | LOC_Os05g12094.1 | downstream_gene_variant ; 2069.0bp to feature; MODIFIER | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| vg0506924589 | G -> A | LOC_Os05g12110.1 | downstream_gene_variant ; 1176.0bp to feature; MODIFIER | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| vg0506924589 | G -> A | LOC_Os05g12100-LOC_Os05g12110 | intergenic_region ; MODIFIER | silent_mutation | Average:7.453; most accessible tissue: Callus, score: 23.072 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506924589 | 4.23E-07 | NA | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 7.12E-07 | 2.48E-07 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 9.63E-07 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 1.97E-06 | 4.96E-10 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | NA | 5.08E-10 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 1.62E-06 | NA | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 9.78E-06 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | NA | 2.65E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 7.25E-08 | NA | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506924589 | 7.03E-07 | 7.83E-10 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |