Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0506904965:

Variant ID: vg0506904965 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6904965
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATGTGATGTAACTAGTCTTCCATCATGTAGACCCCCGTTTTTATAACAGGAATCAATCGTGTAAACAGTACCATTTCCCTGGATCAAGTAGTCTGGTA[T/C]
ACACGAGTTCATAGCTGAAATATCAAATGCACATACACGAGAGTCTAGTGCGAATTATTACATCATAAGCCTGCAGGCGTAGTCTTAAATCATCGGACTG

Reverse complement sequence

CAGTCCGATGATTTAAGACTACGCCTGCAGGCTTATGATGTAATAATTCGCACTAGACTCTCGTGTATGTGCATTTGATATTTCAGCTATGAACTCGTGT[A/G]
TACCAGACTACTTGATCCAGGGAAATGGTACTGTTTACACGATTGATTCCTGTTATAAAAACGGGGGTCTACATGATGGAAGACTAGTTACATCACATGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.60%	15.20%	1.80%	44.50%	NA
All Indica	2759	30.50%	0.80%	2.75%	65.93%	NA
All Japonica	1512	50.50%	44.80%	0.13%	4.50%	NA
Aus	269	29.70%	0.40%	0.37%	69.52%	NA
Indica I	595	9.40%	0.70%	1.85%	88.07%	NA
Indica II	465	49.70%	1.90%	1.94%	46.45%	NA
Indica III	913	33.10%	0.30%	2.08%	64.51%	NA
Indica Intermediate	786	32.10%	0.90%	4.71%	62.34%	NA
Temperate Japonica	767	20.10%	78.50%	0.00%	1.43%	NA
Tropical Japonica	504	88.70%	5.80%	0.20%	5.36%	NA
Japonica Intermediate	241	67.60%	19.50%	0.41%	12.45%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	46.70%	15.60%	6.67%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506904965	T -> DEL	N	N	silent_mutation	Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0506904965	T -> C	LOC_Os05g12060.1	upstream_gene_variant ; 4701.0bp to feature; MODIFIER	silent_mutation	Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0506904965	T -> C	LOC_Os05g12070.1	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0506904965	T -> C	LOC_Os05g12070-LOC_Os05g12080	intergenic_region ; MODIFIER	silent_mutation	Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506904965	NA	2.19E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506904965	NA	4.86E-15	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	3.95E-08	1.19E-23	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	2.74E-06	NA	mr1632	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	3.53E-06	1.63E-07	mr1632	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	NA	4.21E-07	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	NA	1.86E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	NA	1.58E-18	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	4.72E-08	4.52E-31	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	5.57E-06	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965	NA	8.83E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251