\
| Variant ID: vg0506904965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6904965 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCATGTGATGTAACTAGTCTTCCATCATGTAGACCCCCGTTTTTATAACAGGAATCAATCGTGTAAACAGTACCATTTCCCTGGATCAAGTAGTCTGGTA[T/C]
ACACGAGTTCATAGCTGAAATATCAAATGCACATACACGAGAGTCTAGTGCGAATTATTACATCATAAGCCTGCAGGCGTAGTCTTAAATCATCGGACTG
CAGTCCGATGATTTAAGACTACGCCTGCAGGCTTATGATGTAATAATTCGCACTAGACTCTCGTGTATGTGCATTTGATATTTCAGCTATGAACTCGTGT[A/G]
TACCAGACTACTTGATCCAGGGAAATGGTACTGTTTACACGATTGATTCCTGTTATAAAAACGGGGGTCTACATGATGGAAGACTAGTTACATCACATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 15.20% | 1.80% | 44.50% | NA |
| All Indica | 2759 | 30.50% | 0.80% | 2.75% | 65.93% | NA |
| All Japonica | 1512 | 50.50% | 44.80% | 0.13% | 4.50% | NA |
| Aus | 269 | 29.70% | 0.40% | 0.37% | 69.52% | NA |
| Indica I | 595 | 9.40% | 0.70% | 1.85% | 88.07% | NA |
| Indica II | 465 | 49.70% | 1.90% | 1.94% | 46.45% | NA |
| Indica III | 913 | 33.10% | 0.30% | 2.08% | 64.51% | NA |
| Indica Intermediate | 786 | 32.10% | 0.90% | 4.71% | 62.34% | NA |
| Temperate Japonica | 767 | 20.10% | 78.50% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 88.70% | 5.80% | 0.20% | 5.36% | NA |
| Japonica Intermediate | 241 | 67.60% | 19.50% | 0.41% | 12.45% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 15.60% | 6.67% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506904965 | T -> DEL | N | N | silent_mutation | Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0506904965 | T -> C | LOC_Os05g12060.1 | upstream_gene_variant ; 4701.0bp to feature; MODIFIER | silent_mutation | Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0506904965 | T -> C | LOC_Os05g12070.1 | downstream_gene_variant ; 613.0bp to feature; MODIFIER | silent_mutation | Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0506904965 | T -> C | LOC_Os05g12070-LOC_Os05g12080 | intergenic_region ; MODIFIER | silent_mutation | Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506904965 | NA | 2.19E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0506904965 | NA | 4.86E-15 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | 3.95E-08 | 1.19E-23 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | 2.74E-06 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | 3.53E-06 | 1.63E-07 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | NA | 4.21E-07 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | NA | 1.86E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | NA | 1.58E-18 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | 4.72E-08 | 4.52E-31 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | 5.57E-06 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506904965 | NA | 8.83E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |