\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506904965:

Variant ID: vg0506904965 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6904965
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATGTGATGTAACTAGTCTTCCATCATGTAGACCCCCGTTTTTATAACAGGAATCAATCGTGTAAACAGTACCATTTCCCTGGATCAAGTAGTCTGGTA[T/C]
ACACGAGTTCATAGCTGAAATATCAAATGCACATACACGAGAGTCTAGTGCGAATTATTACATCATAAGCCTGCAGGCGTAGTCTTAAATCATCGGACTG

Reverse complement sequence

CAGTCCGATGATTTAAGACTACGCCTGCAGGCTTATGATGTAATAATTCGCACTAGACTCTCGTGTATGTGCATTTGATATTTCAGCTATGAACTCGTGT[A/G]
TACCAGACTACTTGATCCAGGGAAATGGTACTGTTTACACGATTGATTCCTGTTATAAAAACGGGGGTCTACATGATGGAAGACTAGTTACATCACATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 15.20% 1.80% 44.50% NA
All Indica  2759 30.50% 0.80% 2.75% 65.93% NA
All Japonica  1512 50.50% 44.80% 0.13% 4.50% NA
Aus  269 29.70% 0.40% 0.37% 69.52% NA
Indica I  595 9.40% 0.70% 1.85% 88.07% NA
Indica II  465 49.70% 1.90% 1.94% 46.45% NA
Indica III  913 33.10% 0.30% 2.08% 64.51% NA
Indica Intermediate  786 32.10% 0.90% 4.71% 62.34% NA
Temperate Japonica  767 20.10% 78.50% 0.00% 1.43% NA
Tropical Japonica  504 88.70% 5.80% 0.20% 5.36% NA
Japonica Intermediate  241 67.60% 19.50% 0.41% 12.45% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 46.70% 15.60% 6.67% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506904965 T -> DEL N N silent_mutation Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0506904965 T -> C LOC_Os05g12060.1 upstream_gene_variant ; 4701.0bp to feature; MODIFIER silent_mutation Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0506904965 T -> C LOC_Os05g12070.1 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0506904965 T -> C LOC_Os05g12070-LOC_Os05g12080 intergenic_region ; MODIFIER silent_mutation Average:26.642; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506904965 NA 2.19E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506904965 NA 4.86E-15 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 3.95E-08 1.19E-23 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 2.74E-06 NA mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 3.53E-06 1.63E-07 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 NA 4.21E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 NA 1.86E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 NA 1.58E-18 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 4.72E-08 4.52E-31 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 5.57E-06 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506904965 NA 8.83E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251