\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506891804:

Variant ID: vg0506891804 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6891804
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AACTGCATTGACGATACATAAACTTATTTATTTATCATGTGGGTACAATCGTACGAACTTATAAAATATTAAATATTTAGGTATTGATTGTACCCATATG[A/G]
TTAATAAATACTCCATCTGTCCTAAAATATAACAACTTTTAGCTCTTAAGATTTGTCCCAAAATATAACAACTTCCCCACCAACATTCTCTTCCCAACCA

Reverse complement sequence

TGGTTGGGAAGAGAATGTTGGTGGGGAAGTTGTTATATTTTGGGACAAATCTTAAGAGCTAAAAGTTGTTATATTTTAGGACAGATGGAGTATTTATTAA[T/C]
CATATGGGTACAATCAATACCTAAATATTTAATATTTTATAAGTTCGTACGATTGTACCCACATGATAAATAAATAAGTTTATGTATCGTCAATGCAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.80% 15.00% 2.41% 54.78% NA
All Indica  2759 12.40% 0.60% 3.23% 83.80% NA
All Japonica  1512 49.90% 44.80% 0.79% 4.56% NA
Aus  269 31.20% 0.00% 3.35% 65.43% NA
Indica I  595 6.70% 0.50% 3.70% 89.08% NA
Indica II  465 20.00% 1.50% 3.01% 75.48% NA
Indica III  913 11.00% 0.30% 2.52% 86.20% NA
Indica Intermediate  786 13.70% 0.50% 3.82% 81.93% NA
Temperate Japonica  767 19.20% 78.20% 1.04% 1.56% NA
Tropical Japonica  504 88.30% 6.20% 0.40% 5.16% NA
Japonica Intermediate  241 67.20% 19.10% 0.83% 12.86% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 44.40% 16.70% 4.44% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506891804 A -> DEL N N silent_mutation Average:18.745; most accessible tissue: Callus, score: 67.68 N N N N
vg0506891804 A -> G LOC_Os05g12050.1 downstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:18.745; most accessible tissue: Callus, score: 67.68 N N N N
vg0506891804 A -> G LOC_Os05g12060.1 downstream_gene_variant ; 2803.0bp to feature; MODIFIER silent_mutation Average:18.745; most accessible tissue: Callus, score: 67.68 N N N N
vg0506891804 A -> G LOC_Os05g12050-LOC_Os05g12060 intergenic_region ; MODIFIER silent_mutation Average:18.745; most accessible tissue: Callus, score: 67.68 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506891804 NA 5.89E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506891804 3.62E-06 1.59E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 9.46E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 6.86E-08 3.94E-21 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 1.38E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 1.48E-07 3.23E-22 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 2.42E-06 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 2.71E-06 1.29E-11 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 2.62E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 1.28E-06 1.16E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 1.01E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 8.94E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 2.37E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 6.63E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 5.91E-25 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 1.03E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 5.92E-07 2.43E-28 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 5.27E-09 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 8.18E-10 2.71E-14 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 2.36E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506891804 NA 1.09E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251