Variant ID: vg0506765429 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 6765429 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATTAATTTTTGATTTCTCATCTTTTTCAAAGTAAAATAGATAAAACTTATTTGTGAGATTATTCAATAGTTTACATTGAAAGAATTTAGCAATAAAGA[C/T]
TAGTTTTAAACTTTCAATGATATTATTAAAGAGGTAAAATTTAAGTTTTTTTTAAATGACTAGTTTATGTATTGATTGTTATTAACGGTAACTATTTGAC
GTCAAATAGTTACCGTTAATAACAATCAATACATAAACTAGTCATTTAAAAAAAACTTAAATTTTACCTCTTTAATAATATCATTGAAAGTTTAAAACTA[G/A]
TCTTTATTGCTAAATTCTTTCAATGTAAACTATTGAATAATCTCACAAATAAGTTTTATCTATTTTACTTTGAAAAAGATGAGAAATCAAAAATTAATTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.00% | 2.00% | 0.04% | 0.00% | NA |
All Indica | 2759 | 96.60% | 3.30% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 91.50% | 8.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0506765429 | C -> T | LOC_Os05g11860.1 | upstream_gene_variant ; 3928.0bp to feature; MODIFIER | silent_mutation | Average:31.901; most accessible tissue: Callus, score: 74.943 | N | N | N | N |
vg0506765429 | C -> T | LOC_Os05g11870.1 | upstream_gene_variant ; 1065.0bp to feature; MODIFIER | silent_mutation | Average:31.901; most accessible tissue: Callus, score: 74.943 | N | N | N | N |
vg0506765429 | C -> T | LOC_Os05g11860-LOC_Os05g11870 | intergenic_region ; MODIFIER | silent_mutation | Average:31.901; most accessible tissue: Callus, score: 74.943 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0506765429 | 1.09E-07 | NA | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0506765429 | 4.46E-06 | NA | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |