\
| Variant ID: vg0506633865 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6633865 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
CAAATTTCATTCCCATCCATATAACATGTACATTCTGATATTTATCTCATCTCACGCATATTCCAGATTCCACTGGGTCCTATTATTTTTCGACTTGGAC[G/A]
CATGCAGAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTCATAGACAGGTAATATAATGCCATCTATTCCAA
TTGGAATAGATGGCATTATATTACCTGTCTATGAGTTGGAAGACCTTGTCAAAAACCTTCTCCTCTTTATTCATTGAGTCGTACACAGTGACTCTGCATG[C/T]
GTCCAAGTCGAAAAATAATAGGACCCAGTGGAATCTGGAATATGCGTGAGATGAGATAAATATCAGAATGTACATGTTATATGGATGGGAATGAAATTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 3.40% | 7.77% | 0.30% | NA |
| All Indica | 2759 | 92.00% | 2.80% | 4.75% | 0.40% | NA |
| All Japonica | 1512 | 79.70% | 5.40% | 14.95% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 92.10% | 1.30% | 5.21% | 1.34% | NA |
| Indica II | 465 | 94.00% | 1.50% | 4.52% | 0.00% | NA |
| Indica III | 913 | 89.70% | 5.00% | 5.26% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 2.20% | 3.94% | 0.38% | NA |
| Temperate Japonica | 767 | 95.40% | 0.90% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 60.10% | 10.70% | 29.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.50% | 8.30% | 21.16% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506633865 | G -> DEL | N | N | silent_mutation | Average:29.797; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg0506633865 | G -> A | LOC_Os05g11680-LOC_Os05g11700 | intergenic_region ; MODIFIER | silent_mutation | Average:29.797; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506633865 | 2.79E-06 | 2.22E-07 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506633865 | NA | 3.22E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506633865 | NA | 8.73E-09 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506633865 | NA | 2.64E-07 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506633865 | 2.30E-06 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506633865 | 1.62E-09 | 2.24E-14 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506633865 | NA | 9.10E-14 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |