\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506420059:

Variant ID: vg0506420059 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6420059
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 363. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTATTTATTATTATTTGTCATGTGATGCTCAGATGGATTTAGATCATACTCATGAATACATTATCCAACAACAAGCTAGAACTTTGGCCATTTTAGCT[A/G]
CCGTGTTGGCTATTATTCGTTGGCGACGTCGTAAGAAAAATAGACGGATTCCAAGGAAATATGGGCCTTTGGTGGATAGAGATCTGATCAGACAAACAAG

Reverse complement sequence

CTTGTTTGTCTGATCAGATCTCTATCCACCAAAGGCCCATATTTCCTTGGAATCCGTCTATTTTTCTTACGACGTCGCCAACGAATAATAGCCAACACGG[T/C]
AGCTAAAATGGCCAAAGTTCTAGCTTGTTGTTGGATAATGTATTCATGAGTATGATCTAAATCCATCTGAGCATCACATGACAAATAATAATAAATAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 9.00% 4.85% 0.00% NA
All Indica  2759 95.10% 1.50% 3.37% 0.00% NA
All Japonica  1512 66.20% 24.90% 8.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.10% 1.70% 5.21% 0.00% NA
Indica II  465 92.70% 2.40% 4.95% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 93.00% 2.30% 4.71% 0.00% NA
Temperate Japonica  767 39.50% 44.50% 16.04% 0.00% NA
Tropical Japonica  504 97.00% 2.60% 0.40% 0.00% NA
Japonica Intermediate  241 86.70% 9.50% 3.73% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506420059 A -> G LOC_Os05g11360.1 upstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0506420059 A -> G LOC_Os05g11350.1 downstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0506420059 A -> G LOC_Os05g11370.1 intron_variant ; MODIFIER silent_mutation Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506420059 NA 9.14E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 1.40E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 2.32E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 6.73E-06 NA mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 1.84E-07 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 4.67E-06 NA mr1841 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 2.07E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 1.97E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 NA 3.38E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 7.47E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059 2.45E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251