\
| Variant ID: vg0506420059 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6420059 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 363. )
ACCTATTTATTATTATTTGTCATGTGATGCTCAGATGGATTTAGATCATACTCATGAATACATTATCCAACAACAAGCTAGAACTTTGGCCATTTTAGCT[A/G]
CCGTGTTGGCTATTATTCGTTGGCGACGTCGTAAGAAAAATAGACGGATTCCAAGGAAATATGGGCCTTTGGTGGATAGAGATCTGATCAGACAAACAAG
CTTGTTTGTCTGATCAGATCTCTATCCACCAAAGGCCCATATTTCCTTGGAATCCGTCTATTTTTCTTACGACGTCGCCAACGAATAATAGCCAACACGG[T/C]
AGCTAAAATGGCCAAAGTTCTAGCTTGTTGTTGGATAATGTATTCATGAGTATGATCTAAATCCATCTGAGCATCACATGACAAATAATAATAAATAGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.10% | 9.00% | 4.85% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 1.50% | 3.37% | 0.00% | NA |
| All Japonica | 1512 | 66.20% | 24.90% | 8.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 1.70% | 5.21% | 0.00% | NA |
| Indica II | 465 | 92.70% | 2.40% | 4.95% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 2.30% | 4.71% | 0.00% | NA |
| Temperate Japonica | 767 | 39.50% | 44.50% | 16.04% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 2.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 9.50% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506420059 | A -> G | LOC_Os05g11360.1 | upstream_gene_variant ; 2930.0bp to feature; MODIFIER | silent_mutation | Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg0506420059 | A -> G | LOC_Os05g11350.1 | downstream_gene_variant ; 3696.0bp to feature; MODIFIER | silent_mutation | Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg0506420059 | A -> G | LOC_Os05g11370.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506420059 | NA | 9.14E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 1.40E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 2.32E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 6.73E-06 | NA | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 1.84E-07 | NA | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 4.67E-06 | NA | mr1841 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 2.07E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 1.97E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | NA | 3.38E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 7.47E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506420059 | 2.45E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |