Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0506412273:

Variant ID: vg0506412273 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6412273
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AAATATAGGCTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATATGCGAGACTGAGGTAAAAGAGATGG[A/C]
GACAGGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTAATAACCCTACTCCTGTTGGTCGAAGCCGGTCGTTGCTCTTATTCACCATAATCACA

Reverse complement sequence

TGTGATTATGGTGAATAAGAGCAACGACCGGCTTCGACCAACAGGAGTAGGGTTATTACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCCTGTC[T/G]
CCATCTCTTTTACCTCAGTCTCGCATATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGCCTATATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	8.30%	1.38%	1.46%	NA
All Indica	2759	95.50%	3.40%	1.01%	0.11%	NA
All Japonica	1512	81.20%	18.80%	0.00%	0.00%	NA
Aus	269	61.70%	0.00%	13.75%	24.54%	NA
Indica I	595	95.60%	2.90%	1.51%	0.00%	NA
Indica II	465	97.60%	1.90%	0.43%	0.00%	NA
Indica III	913	97.00%	2.80%	0.11%	0.00%	NA
Indica Intermediate	786	92.40%	5.20%	2.04%	0.38%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	56.90%	43.10%	0.00%	0.00%	NA
Japonica Intermediate	241	75.10%	24.90%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506412273	A -> DEL	N	N	silent_mutation	Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0506412273	A -> C	LOC_Os05g11340.1	upstream_gene_variant ; 2414.0bp to feature; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0506412273	A -> C	LOC_Os05g11350.1	upstream_gene_variant ; 2471.0bp to feature; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0506412273	A -> C	LOC_Os05g11360.1	downstream_gene_variant ; 4254.0bp to feature; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0506412273	A -> C	LOC_Os05g11340-LOC_Os05g11350	intergenic_region ; MODIFIER	silent_mutation	Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506412273	2.84E-06	6.23E-10	mr1583	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273	9.34E-08	9.33E-08	mr1929	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273	4.89E-06	2.03E-08	mr1124_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273	NA	1.91E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273	2.97E-08	2.24E-09	mr1850_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273	NA	9.15E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251