| Variant ID: vg0506412273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6412273 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )
AAATATAGGCTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATATGCGAGACTGAGGTAAAAGAGATGG[A/C]
GACAGGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTAATAACCCTACTCCTGTTGGTCGAAGCCGGTCGTTGCTCTTATTCACCATAATCACA
TGTGATTATGGTGAATAAGAGCAACGACCGGCTTCGACCAACAGGAGTAGGGTTATTACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCCTGTC[T/G]
CCATCTCTTTTACCTCAGTCTCGCATATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGCCTATATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 8.30% | 1.38% | 1.46% | NA |
| All Indica | 2759 | 95.50% | 3.40% | 1.01% | 0.11% | NA |
| All Japonica | 1512 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 0.00% | 13.75% | 24.54% | NA |
| Indica I | 595 | 95.60% | 2.90% | 1.51% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.00% | 2.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 5.20% | 2.04% | 0.38% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506412273 | A -> DEL | N | N | silent_mutation | Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412273 | A -> C | LOC_Os05g11340.1 | upstream_gene_variant ; 2414.0bp to feature; MODIFIER | silent_mutation | Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412273 | A -> C | LOC_Os05g11350.1 | upstream_gene_variant ; 2471.0bp to feature; MODIFIER | silent_mutation | Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412273 | A -> C | LOC_Os05g11360.1 | downstream_gene_variant ; 4254.0bp to feature; MODIFIER | silent_mutation | Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412273 | A -> C | LOC_Os05g11340-LOC_Os05g11350 | intergenic_region ; MODIFIER | silent_mutation | Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506412273 | 2.84E-06 | 6.23E-10 | mr1583 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412273 | 9.34E-08 | 9.33E-08 | mr1929 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412273 | 4.89E-06 | 2.03E-08 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412273 | NA | 1.91E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412273 | 2.97E-08 | 2.24E-09 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412273 | NA | 9.15E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |