\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506412273:

Variant ID: vg0506412273 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6412273
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATAGGCTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATATGCGAGACTGAGGTAAAAGAGATGG[A/C]
GACAGGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTAATAACCCTACTCCTGTTGGTCGAAGCCGGTCGTTGCTCTTATTCACCATAATCACA

Reverse complement sequence

TGTGATTATGGTGAATAAGAGCAACGACCGGCTTCGACCAACAGGAGTAGGGTTATTACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCCTGTC[T/G]
CCATCTCTTTTACCTCAGTCTCGCATATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGCCTATATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 8.30% 1.38% 1.46% NA
All Indica  2759 95.50% 3.40% 1.01% 0.11% NA
All Japonica  1512 81.20% 18.80% 0.00% 0.00% NA
Aus  269 61.70% 0.00% 13.75% 24.54% NA
Indica I  595 95.60% 2.90% 1.51% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 97.00% 2.80% 0.11% 0.00% NA
Indica Intermediate  786 92.40% 5.20% 2.04% 0.38% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 56.90% 43.10% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506412273 A -> DEL N N silent_mutation Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412273 A -> C LOC_Os05g11340.1 upstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412273 A -> C LOC_Os05g11350.1 upstream_gene_variant ; 2471.0bp to feature; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412273 A -> C LOC_Os05g11360.1 downstream_gene_variant ; 4254.0bp to feature; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412273 A -> C LOC_Os05g11340-LOC_Os05g11350 intergenic_region ; MODIFIER silent_mutation Average:47.342; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506412273 2.84E-06 6.23E-10 mr1583 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273 9.34E-08 9.33E-08 mr1929 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273 4.89E-06 2.03E-08 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273 NA 1.91E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273 2.97E-08 2.24E-09 mr1850_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412273 NA 9.15E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251