\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506270948:

Variant ID: vg0506270948 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6270948
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.49, T: 0.49, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TATATCATATTTATAAGATAAATATTTTACAAATTATTCACACTAAAAAAATTTTAAATTTTGACATCAGCCTTGTGCAAAAAAGACAAGTATTATCAAC[T/C]
GAGGGAGCAGTACATTACTAGAAATTAATGTGCTAGCAATAAATGGAATATGTCCATTGATTTTTAACCTGTAGATATTTTTTTGAAGATTTTACTGTCC

Reverse complement sequence

GGACAGTAAAATCTTCAAAAAAATATCTACAGGTTAAAAATCAATGGACATATTCCATTTATTGCTAGCACATTAATTTCTAGTAATGTACTGCTCCCTC[A/G]
GTTGATAATACTTGTCTTTTTTGCACAAGGCTGATGTCAAAATTTAAAATTTTTTTAGTGTGAATAATTTGTAAAATATTTATCTTATAAATATGATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 32.80% 0.15% 0.00% NA
All Indica  2759 76.00% 23.80% 0.11% 0.00% NA
All Japonica  1512 58.50% 41.30% 0.26% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 49.20% 50.80% 0.00% 0.00% NA
Indica II  465 83.40% 16.10% 0.43% 0.00% NA
Indica III  913 89.40% 10.60% 0.00% 0.00% NA
Indica Intermediate  786 76.50% 23.40% 0.13% 0.00% NA
Temperate Japonica  767 94.00% 5.70% 0.26% 0.00% NA
Tropical Japonica  504 12.10% 87.70% 0.20% 0.00% NA
Japonica Intermediate  241 42.30% 57.30% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506270948 T -> C LOC_Os05g11140.1 downstream_gene_variant ; 1738.0bp to feature; MODIFIER silent_mutation Average:42.654; most accessible tissue: Callus, score: 80.023 N N N N
vg0506270948 T -> C LOC_Os05g11140.3 downstream_gene_variant ; 1738.0bp to feature; MODIFIER silent_mutation Average:42.654; most accessible tissue: Callus, score: 80.023 N N N N
vg0506270948 T -> C LOC_Os05g11140.2 downstream_gene_variant ; 2358.0bp to feature; MODIFIER silent_mutation Average:42.654; most accessible tissue: Callus, score: 80.023 N N N N
vg0506270948 T -> C LOC_Os05g11130.1 intron_variant ; MODIFIER silent_mutation Average:42.654; most accessible tissue: Callus, score: 80.023 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506270948 NA 9.34E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 2.17E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 8.26E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 3.03E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 2.27E-10 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 7.20E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 1.49E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 1.10E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 6.90E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 9.93E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 2.35E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 3.04E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 1.80E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 5.47E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 6.43E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 8.16E-09 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 6.70E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 1.92E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 8.40E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 2.66E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 4.17E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 8.40E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 3.09E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 2.15E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 3.05E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 1.20E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 3.37E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 9.90E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 4.91E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506270948 NA 3.63E-11 mr1862_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251