\
| Variant ID: vg0505835317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5835317 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTGAAGACCTCAAATTTGTATATTACCACTAAAAATATTTGCTTAAAATTTTGACAGCACCTCCCTCCCTCAAAGCTTAATTTTGAAGCAATGGCTCG[G/A]
GCTGGAGGAGAAAGAATGGGTATATAAAGCTGTGCAACTTTAGTCCCGGTTGGTAACACCAACCGGGCATAAAGATCTCAAATCACTTTAGTCCCGGTTT
AAACCGGGACTAAAGTGATTTGAGATCTTTATGCCCGGTTGGTGTTACCAACCGGGACTAAAGTTGCACAGCTTTATATACCCATTCTTTCTCCTCCAGC[C/T]
CGAGCCATTGCTTCAAAATTAAGCTTTGAGGGAGGGAGGTGCTGTCAAAATTTTAAGCAAATATTTTTAGTGGTAATATACAAATTTGAGGTCTTCAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 21.80% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 4.70% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 8.60% | 91.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 2.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 90.30% | 9.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 14.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505835317 | G -> A | LOC_Os05g10660.1 | upstream_gene_variant ; 486.0bp to feature; MODIFIER | silent_mutation | Average:34.319; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0505835317 | G -> A | LOC_Os05g10660-LOC_Os05g10670 | intergenic_region ; MODIFIER | silent_mutation | Average:34.319; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505835317 | NA | 2.23E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505835317 | NA | 8.76E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 1.35E-16 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 1.36E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 1.88E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 2.60E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 4.34E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 9.82E-09 | mr1363_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 8.02E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505835317 | NA | 6.46E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |