Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505446561:

Variant ID: vg0505446561 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5446561
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTCTATAGACTATCTCTAGATTAGTAGATAACTTTGTTCTCTCTCTTCATTTAATCTCTTTCAAGTAAGAAAATATGCTGACATGGATCTCTTATA[G/A]
GGAGCCTATAGATAACCATTGCGGGTGTCCTTACAATTACACAGCCTAGTTTCACGCTTCACACACTTCCATGGGTAACGAAGTACAGAAGCCCTACAGC

Reverse complement sequence

GCTGTAGGGCTTCTGTACTTCGTTACCCATGGAAGTGTGTGAAGCGTGAAACTAGGCTGTGTAATTGTAAGGACACCCGCAATGGTTATCTATAGGCTCC[C/T]
TATAAGAGATCCATGTCAGCATATTTTCTTACTTGAAAGAGATTAAATGAAGAGAGAGAACAAAGTTATCTACTAATCTAGAGATAGTCTATAGAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.50% 0.02% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 65.20% 34.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 94.00% 6.00% 0.00% 0.00% NA
Tropical Japonica  504 21.20% 78.60% 0.20% 0.00% NA
Japonica Intermediate  241 65.60% 34.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505446561 G -> A LOC_Os05g09640.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:80.719; most accessible tissue: Zhenshan97 panicle, score: 97.174 N N N N
vg0505446561 G -> A LOC_Os05g09650.1 upstream_gene_variant ; 3543.0bp to feature; MODIFIER silent_mutation Average:80.719; most accessible tissue: Zhenshan97 panicle, score: 97.174 N N N N
vg0505446561 G -> A LOC_Os05g09630.1 downstream_gene_variant ; 1485.0bp to feature; MODIFIER silent_mutation Average:80.719; most accessible tissue: Zhenshan97 panicle, score: 97.174 N N N N
vg0505446561 G -> A LOC_Os05g09630.2 downstream_gene_variant ; 1349.0bp to feature; MODIFIER silent_mutation Average:80.719; most accessible tissue: Zhenshan97 panicle, score: 97.174 N N N N
vg0505446561 G -> A LOC_Os05g09630-LOC_Os05g09640 intergenic_region ; MODIFIER silent_mutation Average:80.719; most accessible tissue: Zhenshan97 panicle, score: 97.174 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0505446561 G A -0.06 -0.05 -0.03 -0.1 -0.08 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505446561 NA 1.58E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 2.28E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 6.31E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 5.04E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 4.68E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 8.93E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 2.13E-06 NA mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 6.72E-11 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 3.75E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 1.98E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 7.81E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 2.88E-09 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 1.53E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 1.30E-30 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 1.87E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 3.20E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505446561 NA 1.67E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251