\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504710532:

Variant ID: vg0504710532 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4710532
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGAACCGCTCAATCCCCACCGTCCGATCCGAGACGCGTTTCAGCGAGCGGCAAACGATGGATACAGCTCACCCTTCTCTTCCCCCACACCCCAAAAATT[T/A]
TTTTAAAAAAAGCATATCCAAAGATTCCTACCCAAAAAAAAGAGCAGATTTTTTCCCTTTTTCCAAATATACTTCGCCACTGCAACGCAAAGGACGAAGA

Reverse complement sequence

TCTTCGTCCTTTGCGTTGCAGTGGCGAAGTATATTTGGAAAAAGGGAAAAAATCTGCTCTTTTTTTTGGGTAGGAATCTTTGGATATGCTTTTTTTAAAA[A/T]
AATTTTTGGGGTGTGGGGGAAGAGAAGGGTGAGCTGTATCCATCGTTTGCCGCTCGCTGAAACGCGTCTCGGATCGGACGGTGGGGATTGAGCGGTTCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 44.00% 1.82% 0.23% NA
All Indica  2759 89.30% 9.60% 0.72% 0.33% NA
All Japonica  1512 1.50% 98.10% 0.40% 0.07% NA
Aus  269 11.90% 87.70% 0.37% 0.00% NA
Indica I  595 97.00% 1.00% 1.34% 0.67% NA
Indica II  465 89.70% 9.50% 0.43% 0.43% NA
Indica III  913 88.70% 10.70% 0.55% 0.00% NA
Indica Intermediate  786 84.00% 15.00% 0.64% 0.38% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 0.80% 98.80% 0.40% 0.00% NA
Japonica Intermediate  241 1.20% 97.10% 1.24% 0.41% NA
VI/Aromatic  96 2.10% 38.50% 59.38% 0.00% NA
Intermediate  90 31.10% 65.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504710532 T -> DEL N N silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08610.1 upstream_gene_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08610.2 upstream_gene_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08610.4 upstream_gene_variant ; 63.0bp to feature; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08610.3 upstream_gene_variant ; 92.0bp to feature; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08600.1 downstream_gene_variant ; 1875.0bp to feature; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08600.2 downstream_gene_variant ; 1875.0bp to feature; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N
vg0504710532 T -> A LOC_Os05g08600-LOC_Os05g08610 intergenic_region ; MODIFIER silent_mutation Average:98.631; most accessible tissue: Callus, score: 99.775 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0504710532 T A 0.09 0.09 0.07 0.04 0.06 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504710532 NA 3.75E-32 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 1.67E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 3.52E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 4.03E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 5.95E-75 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 4.66E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 6.16E-54 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 5.26E-55 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 8.60E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 1.67E-61 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 3.43E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 2.88E-06 2.73E-07 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 4.91E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 5.06E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 3.97E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 1.19E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 1.17E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504710532 NA 1.60E-38 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251