\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504703202:

Variant ID: vg0504703202 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4703202
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCACCGGCAAGGTTGCCCTCACGCAGCTCAACATCGAGACCAGCATCCCCGTCACTGAGATTGAGTCGCTCGTCCTCTTCAACGTGTCCTCCACCATC[A/G]
CCACGCCGGTCACCGGCCGCCACTCCCCCATCTCCCATTGGCCGCCTCTCCCACGCTCTCCGGCTGGCCACGTTGGAAGAAAAGAGAAGAAAGAATAGAA

Reverse complement sequence

TTCTATTCTTTCTTCTCTTTTCTTCCAACGTGGCCAGCCGGAGAGCGTGGGAGAGGCGGCCAATGGGAGATGGGGGAGTGGCGGCCGGTGACCGGCGTGG[T/C]
GATGGTGGAGGACACGTTGAAGAGGACGAGCGACTCAATCTCAGTGACGGGGATGCTGGTCTCGATGTTGAGCTGCGTGAGGGCAACCTTGCCGGTGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 17.60% 0.15% 1.42% NA
All Indica  2759 96.80% 3.00% 0.00% 0.18% NA
All Japonica  1512 68.30% 31.00% 0.26% 0.40% NA
Aus  269 9.70% 90.00% 0.37% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.50% 2.10% 0.00% 0.44% NA
Indica Intermediate  786 94.10% 5.70% 0.00% 0.13% NA
Temperate Japonica  767 67.80% 31.80% 0.26% 0.13% NA
Tropical Japonica  504 81.50% 18.30% 0.00% 0.20% NA
Japonica Intermediate  241 42.30% 55.20% 0.83% 1.66% NA
VI/Aromatic  96 22.90% 18.80% 1.04% 57.29% NA
Intermediate  90 75.60% 22.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504703202 A -> DEL LOC_Os05g08590.1 N frameshift_variant Average:78.98; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0504703202 A -> G LOC_Os05g08590.1 missense_variant ; p.Thr92Ala; MODERATE nonsynonymous_codon ; T92A Average:78.98; most accessible tissue: Zhenshan97 young leaf, score: 84.624 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504703202 NA 1.17E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504703202 NA 7.62E-17 mr1180 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 2.71E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 4.58E-18 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 2.54E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 2.70E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 7.73E-18 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 3.41E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 4.09E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 1.64E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 2.74E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 1.61E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 1.11E-21 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 2.16E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 4.99E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 2.45E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504703202 NA 1.27E-13 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251