\
| Variant ID: vg0504619344 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 4619344 |
| Reference Allele: A | Alternative Allele: G,AG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 159. )
TTTCTTTTGTTTTTTCGATATAACTGTCAAGTAGATATCACGTCTGCACATATGAGACTAAGTTAATGTCACGTCAACGAAAACCGTTCTCCAAAAAAGG[A/G,AG]
AGTAATTTTGTATGGTTATGTTCTCAAAACAATAATGGGAGTACTTAGAGGACTCGGCATATTCGATATTCGGTTTTGCGTTTGCGGTTATGGCTTTCAC
GTGAAAGCCATAACCGCAAACGCAAAACCGAATATCGAATATGCCGAGTCCTCTAAGTACTCCCATTATTGTTTTGAGAACATAACCATACAAAATTACT[T/C,CT]
CCTTTTTTGGAGAACGGTTTTCGTTGACGTGACATTAACTTAGTCTCATATGTGCAGACGTGATATCTACTTGACAGTTATATCGAAAAAACAAAAGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 31.20% | 0.15% | 0.00% | AG: 0.89% |
| All Indica | 2759 | 97.80% | 2.00% | 0.11% | 0.00% | AG: 0.11% |
| All Japonica | 1512 | 11.20% | 88.50% | 0.13% | 0.00% | AG: 0.20% |
| Aus | 269 | 84.80% | 2.60% | 0.00% | 0.00% | AG: 12.64% |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.70% | 0.11% | 0.00% | AG: 0.11% |
| Indica Intermediate | 786 | 96.40% | 3.20% | 0.13% | 0.00% | AG: 0.25% |
| Temperate Japonica | 767 | 2.30% | 97.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.20% | 73.20% | 0.20% | 0.00% | AG: 0.40% |
| Japonica Intermediate | 241 | 7.90% | 91.30% | 0.41% | 0.00% | AG: 0.41% |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 46.70% | 2.22% | 0.00% | AG: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504619344 | A -> AG | LOC_Os05g08450.1 | downstream_gene_variant ; 4043.0bp to feature; MODIFIER | silent_mutation | Average:75.672; most accessible tissue: Callus, score: 96.294 | N | N | N | N |
| vg0504619344 | A -> AG | LOC_Os05g08460.1 | downstream_gene_variant ; 2216.0bp to feature; MODIFIER | silent_mutation | Average:75.672; most accessible tissue: Callus, score: 96.294 | N | N | N | N |
| vg0504619344 | A -> AG | LOC_Os05g08450-LOC_Os05g08460 | intergenic_region ; MODIFIER | silent_mutation | Average:75.672; most accessible tissue: Callus, score: 96.294 | N | N | N | N |
| vg0504619344 | A -> G | LOC_Os05g08450.1 | downstream_gene_variant ; 4042.0bp to feature; MODIFIER | silent_mutation | Average:75.672; most accessible tissue: Callus, score: 96.294 | N | N | N | N |
| vg0504619344 | A -> G | LOC_Os05g08460.1 | downstream_gene_variant ; 2217.0bp to feature; MODIFIER | silent_mutation | Average:75.672; most accessible tissue: Callus, score: 96.294 | N | N | N | N |
| vg0504619344 | A -> G | LOC_Os05g08450-LOC_Os05g08460 | intergenic_region ; MODIFIER | silent_mutation | Average:75.672; most accessible tissue: Callus, score: 96.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504619344 | NA | 1.15E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.97E-67 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 5.59E-26 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 8.62E-40 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.13E-31 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 9.77E-59 | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 8.22E-31 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.18E-38 | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 4.89E-27 | mr1145 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.41E-30 | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.30E-31 | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 5.89E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 9.26E-63 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.85E-15 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.63E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 6.28E-14 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.37E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.48E-26 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.50E-28 | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 5.80E-41 | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.37E-46 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.09E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.77E-52 | mr1070_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.09E-37 | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.57E-35 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.72E-34 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.64E-78 | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.63E-72 | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.07E-41 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.26E-38 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 5.31E-36 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.72E-47 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 4.21E-38 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.09E-37 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.09E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.64E-38 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 4.49E-44 | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.97E-26 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 7.00E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.29E-78 | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.51E-44 | mr1264_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.07E-25 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 5.46E-62 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.14E-54 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 5.67E-51 | mr1437_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.04E-60 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.46E-51 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 1.56E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 3.07E-38 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.58E-34 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504619344 | NA | 2.31E-25 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |