\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504497819:

Variant ID: vg0504497819 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4497819
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGGAATAGACGCGAAAGTACATAACTACCCTCCCACCCACGGTACCGCTTCAAGGCAGAGGTGCGGTACCATGAGGTACAGATGATTTTTGACCGTCC[G/A,C]
ATGAGGCCTGATCAACGGTCACGATTTGGTACTGCACAGCCTCAAGGACAGTAAAAATGCTCTATTTTTTAACTTCATTTATCACGGGAGTCAATCCAAT

Reverse complement sequence

ATTGGATTGACTCCCGTGATAAATGAAGTTAAAAAATAGAGCATTTTTACTGTCCTTGAGGCTGTGCAGTACCAAATCGTGACCGTTGATCAGGCCTCAT[C/T,G]
GGACGGTCAAAAATCATCTGTACCTCATGGTACCGCACCTCTGCCTTGAAGCGGTACCGTGGGTGGGAGGGTAGTTATGTACTTTCGCGTCTATTCCGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 1.70% 15.85% 30.32% NA
All Indica  2759 21.70% 2.80% 26.06% 49.40% NA
All Japonica  1512 96.80% 0.00% 1.32% 1.92% NA
Aus  269 94.80% 0.00% 1.12% 4.09% NA
Indica I  595 14.30% 2.00% 15.46% 68.24% NA
Indica II  465 15.10% 1.90% 25.81% 57.20% NA
Indica III  913 29.40% 3.90% 35.49% 31.22% NA
Indica Intermediate  786 22.40% 2.70% 23.28% 51.65% NA
Temperate Japonica  767 98.60% 0.00% 0.13% 1.30% NA
Tropical Japonica  504 92.70% 0.00% 3.57% 3.77% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 0.00% 2.08% 10.42% NA
Intermediate  90 71.10% 1.10% 5.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504497819 G -> DEL N N silent_mutation Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0504497819 G -> C LOC_Os05g08250.1 upstream_gene_variant ; 3215.0bp to feature; MODIFIER N Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0504497819 G -> C LOC_Os05g08240.1 intron_variant ; MODIFIER N Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0504497819 G -> A LOC_Os05g08250.1 upstream_gene_variant ; 3215.0bp to feature; MODIFIER silent_mutation Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0504497819 G -> A LOC_Os05g08240.1 intron_variant ; MODIFIER silent_mutation Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504497819 NA 9.66E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 2.15E-25 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.21E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 4.80E-24 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 2.72E-06 9.46E-09 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 4.51E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 2.72E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 8.21E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 4.97E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.36E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.76E-53 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 4.50E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 6.65E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 2.79E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 3.49E-32 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.53E-30 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 8.28E-31 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 3.08E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 6.06E-33 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 1.84E-06 5.18E-15 mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 2.03E-09 1.02E-14 mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 6.24E-26 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 4.81E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 7.19E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 2.60E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 5.76E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 7.32E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 5.57E-25 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 9.87E-63 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 5.85E-59 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.65E-37 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.51E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.62E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 1.82E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 9.62E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 5.47E-31 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819 NA 6.07E-64 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251