Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504497819:

Variant ID: vg0504497819 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4497819
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TGCGGAATAGACGCGAAAGTACATAACTACCCTCCCACCCACGGTACCGCTTCAAGGCAGAGGTGCGGTACCATGAGGTACAGATGATTTTTGACCGTCC[G/A,C]
ATGAGGCCTGATCAACGGTCACGATTTGGTACTGCACAGCCTCAAGGACAGTAAAAATGCTCTATTTTTTAACTTCATTTATCACGGGAGTCAATCCAAT

Reverse complement sequence

ATTGGATTGACTCCCGTGATAAATGAAGTTAAAAAATAGAGCATTTTTACTGTCCTTGAGGCTGTGCAGTACCAAATCGTGACCGTTGATCAGGCCTCAT[C/T,G]
GGACGGTCAAAAATCATCTGTACCTCATGGTACCGCACCTCTGCCTTGAAGCGGTACCGTGGGTGGGAGGGTAGTTATGTACTTTCGCGTCTATTCCGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	1.70%	15.85%	30.32%	NA
All Indica	2759	21.70%	2.80%	26.06%	49.40%	NA
All Japonica	1512	96.80%	0.00%	1.32%	1.92%	NA
Aus	269	94.80%	0.00%	1.12%	4.09%	NA
Indica I	595	14.30%	2.00%	15.46%	68.24%	NA
Indica II	465	15.10%	1.90%	25.81%	57.20%	NA
Indica III	913	29.40%	3.90%	35.49%	31.22%	NA
Indica Intermediate	786	22.40%	2.70%	23.28%	51.65%	NA
Temperate Japonica	767	98.60%	0.00%	0.13%	1.30%	NA
Tropical Japonica	504	92.70%	0.00%	3.57%	3.77%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	87.50%	0.00%	2.08%	10.42%	NA
Intermediate	90	71.10%	1.10%	5.56%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504497819	G -> DEL	N	N	silent_mutation	Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0504497819	G -> C	LOC_Os05g08250.1	upstream_gene_variant ; 3215.0bp to feature; MODIFIER	N	Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0504497819	G -> C	LOC_Os05g08240.1	intron_variant ; MODIFIER	N	Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0504497819	G -> A	LOC_Os05g08250.1	upstream_gene_variant ; 3215.0bp to feature; MODIFIER	silent_mutation	Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0504497819	G -> A	LOC_Os05g08240.1	intron_variant ; MODIFIER	silent_mutation	Average:15.426; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504497819	NA	9.66E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	2.15E-25	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.21E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	4.80E-24	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	2.72E-06	9.46E-09	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	4.51E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	2.72E-58	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	8.21E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	4.97E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.36E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.76E-53	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	4.50E-34	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	6.65E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	2.79E-30	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	3.49E-32	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.53E-30	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	8.28E-31	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	3.08E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	6.06E-33	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	1.84E-06	5.18E-15	mr1301	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	2.03E-09	1.02E-14	mr1410	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	6.24E-26	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	4.81E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	7.19E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	2.60E-40	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	5.76E-42	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	7.32E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	5.57E-25	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	9.87E-63	mr1970	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	5.85E-59	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.65E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.51E-27	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.62E-47	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	1.82E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	9.62E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	5.47E-31	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504497819	NA	6.07E-64	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251