\
| Variant ID: vg0504497766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4497766 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )
TCTCTCGCCAAACAGAGAAGGAAACAGAGAAGGAAGGGATGCTGCGTGCGTGATGCGGAATAGACGCGAAAGTACATAACTACCCTCCCACCCACGGTAC[C/T]
GCTTCAAGGCAGAGGTGCGGTACCATGAGGTACAGATGATTTTTGACCGTCCGATGAGGCCTGATCAACGGTCACGATTTGGTACTGCACAGCCTCAAGG
CCTTGAGGCTGTGCAGTACCAAATCGTGACCGTTGATCAGGCCTCATCGGACGGTCAAAAATCATCTGTACCTCATGGTACCGCACCTCTGCCTTGAAGC[G/A]
GTACCGTGGGTGGGAGGGTAGTTATGTACTTTCGCGTCTATTCCGCATCACGCACGCAGCATCCCTTCCTTCTCTGTTTCCTTCTCTGTTTGGCGAGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 7.10% | 12.38% | 28.84% | NA |
| All Indica | 2759 | 20.40% | 12.10% | 20.41% | 47.08% | NA |
| All Japonica | 1512 | 97.70% | 0.00% | 0.46% | 1.85% | NA |
| Aus | 269 | 94.80% | 0.00% | 1.86% | 3.35% | NA |
| Indica I | 595 | 14.10% | 7.90% | 12.94% | 65.04% | NA |
| Indica II | 465 | 15.70% | 13.10% | 16.34% | 54.84% | NA |
| Indica III | 913 | 26.20% | 14.90% | 28.81% | 30.12% | NA |
| Indica Intermediate | 786 | 21.10% | 11.60% | 18.70% | 48.60% | NA |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.26% | 1.17% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 0.79% | 3.57% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 4.17% | 8.33% | NA |
| Intermediate | 90 | 70.00% | 2.20% | 6.67% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504497766 | C -> T | LOC_Os05g08250.1 | upstream_gene_variant ; 3268.0bp to feature; MODIFIER | silent_mutation | Average:16.68; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0504497766 | C -> T | LOC_Os05g08240.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.68; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0504497766 | C -> DEL | N | N | silent_mutation | Average:16.68; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504497766 | NA | 1.73E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 6.16E-50 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 8.22E-10 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 2.77E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 1.73E-26 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 3.54E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 7.69E-59 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 2.38E-37 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 6.42E-28 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | 2.00E-06 | NA | mr1301_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | 1.77E-06 | NA | mr1410_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 2.31E-14 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 1.68E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 2.19E-29 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504497766 | NA | 1.05E-07 | mr1993_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |