\
| Variant ID: vg0504496516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4496516 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGCCGTGGCTTCAACGCCGCCGCATAGACGTCGCCGTCTCCACCCGCCGCATCCGCCGTCGCAGGCGCATCAACATCGCCGCCTCCACCCCGTCCCATCC[A/G]
CCGTCGTAGCCACCCCGAAGACTCCGGCATCTTTTCCACCATCTGGTGTGGACTCTGTCGTAATAAGAACTAAATTTGAAATGTGCTTCATCTGGATTTG
CAAATCCAGATGAAGCACATTTCAAATTTAGTTCTTATTACGACAGAGTCCACACCAGATGGTGGAAAAGATGCCGGAGTCTTCGGGGTGGCTACGACGG[T/C]
GGATGGGACGGGGTGGAGGCGGCGATGTTGATGCGCCTGCGACGGCGGATGCGGCGGGTGGAGACGGCGACGTCTATGCGGCGGCGTTGAAGCCACGGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.20% | 2.80% | 7.02% | 55.97% | NA |
| All Indica | 2759 | 5.80% | 0.70% | 2.28% | 91.16% | NA |
| All Japonica | 1512 | 88.00% | 2.80% | 5.29% | 3.84% | NA |
| Aus | 269 | 1.50% | 22.70% | 63.57% | 12.27% | NA |
| Indica I | 595 | 10.40% | 0.00% | 0.34% | 89.24% | NA |
| Indica II | 465 | 6.50% | 0.20% | 2.15% | 91.18% | NA |
| Indica III | 913 | 1.40% | 0.80% | 1.64% | 96.17% | NA |
| Indica Intermediate | 786 | 7.10% | 1.50% | 4.58% | 86.77% | NA |
| Temperate Japonica | 767 | 97.90% | 0.10% | 0.39% | 1.56% | NA |
| Tropical Japonica | 504 | 70.80% | 6.70% | 13.69% | 8.73% | NA |
| Japonica Intermediate | 241 | 92.50% | 3.30% | 3.32% | 0.83% | NA |
| VI/Aromatic | 96 | 75.00% | 6.20% | 7.29% | 11.46% | NA |
| Intermediate | 90 | 54.40% | 2.20% | 12.22% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504496516 | A -> DEL | LOC_Os05g08240.1 | N | frameshift_variant | Average:9.012; most accessible tissue: Callus, score: 39.39 | N | N | N | N |
| vg0504496516 | A -> G | LOC_Os05g08240.1 | missense_variant ; p.Trp86Arg; MODERATE | nonsynonymous_codon ; W86R | Average:9.012; most accessible tissue: Callus, score: 39.39 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504496516 | NA | 2.78E-09 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 8.62E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 3.38E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 4.06E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 8.21E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 3.11E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 5.67E-08 | mr1668_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 1.75E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 5.21E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496516 | NA | 3.28E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |