\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504496516:

Variant ID: vg0504496516 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4496516
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGTGGCTTCAACGCCGCCGCATAGACGTCGCCGTCTCCACCCGCCGCATCCGCCGTCGCAGGCGCATCAACATCGCCGCCTCCACCCCGTCCCATCC[A/G]
CCGTCGTAGCCACCCCGAAGACTCCGGCATCTTTTCCACCATCTGGTGTGGACTCTGTCGTAATAAGAACTAAATTTGAAATGTGCTTCATCTGGATTTG

Reverse complement sequence

CAAATCCAGATGAAGCACATTTCAAATTTAGTTCTTATTACGACAGAGTCCACACCAGATGGTGGAAAAGATGCCGGAGTCTTCGGGGTGGCTACGACGG[T/C]
GGATGGGACGGGGTGGAGGCGGCGATGTTGATGCGCCTGCGACGGCGGATGCGGCGGGTGGAGACGGCGACGTCTATGCGGCGGCGTTGAAGCCACGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 2.80% 7.02% 55.97% NA
All Indica  2759 5.80% 0.70% 2.28% 91.16% NA
All Japonica  1512 88.00% 2.80% 5.29% 3.84% NA
Aus  269 1.50% 22.70% 63.57% 12.27% NA
Indica I  595 10.40% 0.00% 0.34% 89.24% NA
Indica II  465 6.50% 0.20% 2.15% 91.18% NA
Indica III  913 1.40% 0.80% 1.64% 96.17% NA
Indica Intermediate  786 7.10% 1.50% 4.58% 86.77% NA
Temperate Japonica  767 97.90% 0.10% 0.39% 1.56% NA
Tropical Japonica  504 70.80% 6.70% 13.69% 8.73% NA
Japonica Intermediate  241 92.50% 3.30% 3.32% 0.83% NA
VI/Aromatic  96 75.00% 6.20% 7.29% 11.46% NA
Intermediate  90 54.40% 2.20% 12.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504496516 A -> DEL LOC_Os05g08240.1 N frameshift_variant Average:9.012; most accessible tissue: Callus, score: 39.39 N N N N
vg0504496516 A -> G LOC_Os05g08240.1 missense_variant ; p.Trp86Arg; MODERATE nonsynonymous_codon ; W86R Average:9.012; most accessible tissue: Callus, score: 39.39 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504496516 NA 2.78E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 8.62E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 3.38E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 4.06E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 8.21E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 3.11E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 5.67E-08 mr1668_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 1.75E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 5.21E-07 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504496516 NA 3.28E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251