\
| Variant ID: vg0504291251 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4291251 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 93. )
CCGGACTAGAGTTGGATATCAAATGGAGCACGCCCCACTTAGAGACAGAGTCGTAACTTTTCTTGCATTTGTCAAAGTTATTTCCATTTGCACCCTAGAC[T/C]
CTAACATATATCTTCTCACGCTTTCAGTCGAGAGAGCTCCTCAGGAGTGTGAATGAAATGGGGCATGCCCTCCAAGCTCCGAGGGGTGGTGAGGACACGG
CCGTGTCCTCACCACCCCTCGGAGCTTGGAGGGCATGCCCCATTTCATTCACACTCCTGAGGAGCTCTCTCGACTGAAAGCGTGAGAAGATATATGTTAG[A/G]
GTCTAGGGTGCAAATGGAAATAACTTTGACAAATGCAAGAAAAGTTACGACTCTGTCTCTAAGTGGGGCGTGCTCCATTTGATATCCAACTCTAGTCCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 29.90% | 19.64% | 12.55% | NA |
| All Indica | 2759 | 10.70% | 49.10% | 20.44% | 19.68% | NA |
| All Japonica | 1512 | 89.90% | 0.70% | 7.94% | 1.39% | NA |
| Aus | 269 | 4.10% | 8.20% | 82.16% | 5.58% | NA |
| Indica I | 595 | 21.50% | 61.50% | 10.08% | 6.89% | NA |
| Indica II | 465 | 7.30% | 41.90% | 22.80% | 27.96% | NA |
| Indica III | 913 | 5.00% | 49.20% | 21.36% | 24.42% | NA |
| Indica Intermediate | 786 | 11.20% | 44.00% | 25.83% | 18.96% | NA |
| Temperate Japonica | 767 | 97.40% | 1.30% | 1.17% | 0.13% | NA |
| Tropical Japonica | 504 | 77.00% | 0.00% | 19.64% | 3.37% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.40% | 4.98% | 1.24% | NA |
| VI/Aromatic | 96 | 82.30% | 2.10% | 11.46% | 4.17% | NA |
| Intermediate | 90 | 52.20% | 23.30% | 13.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504291251 | T -> DEL | N | N | silent_mutation | Average:15.47; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 | N | N | N | N |
| vg0504291251 | T -> C | LOC_Os05g07920.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.47; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504291251 | 2.84E-06 | NA | mr1076 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 1.61E-06 | 6.77E-06 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 1.50E-07 | 9.53E-07 | mr1086 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 7.32E-07 | 6.96E-07 | mr1103 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 8.45E-08 | 3.07E-07 | mr1104 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 7.43E-07 | 2.56E-07 | mr1107 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 1.87E-07 | 4.00E-07 | mr1226 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 4.98E-06 | 3.19E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 1.46E-06 | NA | mr1411 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504291251 | 3.46E-06 | 1.42E-06 | mr1560 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |