\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503964542:

Variant ID: vg0503964542 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3964542
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTAGACCGGCGCAGCCCGCGGTCTGACCGGCCGACACTGTGTCGGTTGGTTTCGGGTTGTTTGTTTGGATATCCGTGATTGTTTCATGATTATAGCTT[C/T]
TAGATGGATACTATGCGTATGTAATACTGTTGTTTGCTACTAATGAGTCAAGTTGGGGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTGTTCCATGT

Reverse complement sequence

ACATGGAACAAACAAAGAAACCATATTCCGAGACCAAGCTATCCCCAACTTGACTCATTAGTAGCAAACAACAGTATTACATACGCATAGTATCCATCTA[G/A]
AAGCTATAATCATGAAACAATCACGGATATCCAAACAAACAACCCGAAACCAACCGACACAGTGTCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 6.90% 0.11% 1.35% NA
All Indica  2759 96.70% 3.20% 0.07% 0.00% NA
All Japonica  1512 95.20% 0.40% 0.20% 4.23% NA
Aus  269 16.40% 83.60% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.70% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 97.20% 0.20% 0.00% 2.58% NA
Japonica Intermediate  241 75.90% 2.10% 1.24% 20.75% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503964542 C -> T LOC_Os05g07430.1 upstream_gene_variant ; 3583.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503964542 C -> T LOC_Os05g07440.1 downstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503964542 C -> T LOC_Os05g07430-LOC_Os05g07440 intergenic_region ; MODIFIER silent_mutation Average:67.066; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503964542 C -> DEL N N silent_mutation Average:67.066; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503964542 NA 6.16E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 2.53E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 7.81E-34 mr1098 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 4.55E-30 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 8.25E-29 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 5.36E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 5.20E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 6.11E-22 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 1.11E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 1.90E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.15E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.95E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.17E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 4.77E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 9.81E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 9.34E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.81E-24 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 1.59E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 2.83E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 7.27E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 2.22E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 2.03E-25 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.71E-27 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.98E-18 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 4.11E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 1.52E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 2.34E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 7.66E-33 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.09E-26 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 1.71E-21 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 1.22E-22 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 4.07E-15 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 8.74E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503964542 NA 3.43E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251