Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503840950:

Variant ID: vg0503840950 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3840950
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GCTATGTCTATCTGTATGCTAAAATTGTTCATATGGTTGATTTTTTATCCATATTTCTCCCCTGGTTTAGTGCTGATTGCTGGTTCTGTTTTAGTTACCT[T/C]
TCAGATGTGCCTAACTGCCTAATTCAGTTGCTATTGTTTTATCCAGTGAGACCATGGAACAAGAACGGAAAGGAGAAGTTTCCATTGGCATGTATACTTA

Reverse complement sequence

TAAGTATACATGCCAATGGAAACTTCTCCTTTCCGTTCTTGTTCCATGGTCTCACTGGATAAAACAATAGCAACTGAATTAGGCAGTTAGGCACATCTGA[A/G]
AGGTAACTAAAACAGAACCAGCAATCAGCACTAAACCAGGGGAGAAATATGGATAAAAAATCAACCATATGAACAATTTTAGCATACAGATAGACATAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	40.20%	0.23%	0.15%	NA
All Indica	2759	86.50%	13.00%	0.22%	0.25%	NA
All Japonica	1512	1.90%	98.00%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.00%	2.70%	0.34%	0.00%	NA
Indica II	465	74.40%	24.30%	0.65%	0.65%	NA
Indica III	913	88.50%	11.30%	0.11%	0.11%	NA
Indica Intermediate	786	83.30%	16.30%	0.00%	0.38%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.20%	0.20%	0.00%	NA
Japonica Intermediate	241	4.60%	95.00%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	41.10%	55.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503840950	T -> DEL	N	N	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0503840950	T -> C	LOC_Os05g07250.1	downstream_gene_variant ; 1620.0bp to feature; MODIFIER	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0503840950	T -> C	LOC_Os05g07270.1	downstream_gene_variant ; 2824.0bp to feature; MODIFIER	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0503840950	T -> C	LOC_Os05g07260.1	intron_variant ; MODIFIER	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0503840950	T -> C	LOC_Os05g07260.2	intron_variant ; MODIFIER	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0503840950	T -> C	LOC_Os05g07260.4	intron_variant ; MODIFIER	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0503840950	T -> C	LOC_Os05g07260.3	intron_variant ; MODIFIER	silent_mutation	Average:61.589; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503840950	NA	5.71E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	1.73E-09	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	2.83E-06	NA	mr1070_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	2.20E-06	NA	mr1076_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	1.50E-06	NA	mr1083_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	5.70E-07	NA	mr1085_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	4.39E-06	NA	mr1088_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	7.80E-06	NA	mr1103_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	1.11E-06	NA	mr1145_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	4.79E-15	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	1.17E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	4.50E-06	NA	mr1216_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	8.38E-09	4.77E-09	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	2.56E-06	NA	mr1437_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	1.80E-06	6.39E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	4.87E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	2.26E-06	1.36E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	6.80E-19	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	1.24E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503840950	NA	5.29E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251