| Variant ID: vg0503396062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3396062 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGGAGCTTCTACTTCGACCAAGAATATTAAGAATCATTGTTTAGCTCCTAGAAAACAACCACAGCCGAAGTGGATACCTTCTGGCTTATCTCGTTCTCA[G/A]
AAGAGGAGGTTACAACGTCTTCGGGCCATAGGTAAAAAAGAAAAGGAGGCCGAAGATGTAGAGAACAAAACATGTAATAATTTAGAGCCTCGAACGACAC
GTGTCGTTCGAGGCTCTAAATTATTACATGTTTTGTTCTCTACATCTTCGGCCTCCTTTTCTTTTTTACCTATGGCCCGAAGACGTTGTAACCTCCTCTT[C/T]
TGAGAACGAGATAAGCCAGAAGGTATCCACTTCGGCTGTGGTTGTTTTCTAGGAGCTAAACAATGATTCTTAATATTCTTGGTCGAAGTAGAAGCTCCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 0.20% | 2.33% | 16.89% | NA |
| All Indica | 2759 | 70.60% | 0.20% | 3.48% | 25.73% | NA |
| All Japonica | 1512 | 93.80% | 0.10% | 0.73% | 5.36% | NA |
| Aus | 269 | 98.50% | 0.40% | 0.00% | 1.12% | NA |
| Indica I | 595 | 36.50% | 0.20% | 4.03% | 59.33% | NA |
| Indica II | 465 | 79.10% | 0.20% | 4.73% | 15.91% | NA |
| Indica III | 913 | 87.60% | 0.20% | 2.63% | 9.53% | NA |
| Indica Intermediate | 786 | 71.50% | 0.30% | 3.31% | 24.94% | NA |
| Temperate Japonica | 767 | 93.60% | 0.00% | 0.78% | 5.61% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.00% | 1.24% | 15.35% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503396062 | G -> DEL | N | N | silent_mutation | Average:37.947; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0503396062 | G -> A | LOC_Os05g06570.1 | downstream_gene_variant ; 183.0bp to feature; MODIFIER | silent_mutation | Average:37.947; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0503396062 | G -> A | LOC_Os05g06580.1 | downstream_gene_variant ; 2908.0bp to feature; MODIFIER | silent_mutation | Average:37.947; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0503396062 | G -> A | LOC_Os05g06570-LOC_Os05g06580 | intergenic_region ; MODIFIER | silent_mutation | Average:37.947; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503396062 | 1.55E-06 | NA | mr1933 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503396062 | 2.37E-09 | 2.38E-09 | mr1957 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503396062 | 1.35E-06 | 1.35E-06 | mr1957 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |