\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503312521:

Variant ID: vg0503312521 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3312521
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCACCCGGATGGCGTCGTGGCGGGGGTTGCAGCTCGGGCGCCGCCGACGGCGGCGGAGCTAGGGTTTTGGGGGGTTTGCTTCGCGTGGACGCTAGGG[C/A]
TTGCGCCGCCGCGGGCCACCAACTGCGGGGAGTGGAGTGGTGGGTGGGTGGGGGACGAAGCGGAGATTTGTGAGCGACGGGGAAAATGGGGAGAGGATTG

Reverse complement sequence

CAATCCTCTCCCCATTTTCCCCGTCGCTCACAAATCTCCGCTTCGTCCCCCACCCACCCACCACTCCACTCCCCGCAGTTGGTGGCCCGCGGCGGCGCAA[G/T]
CCCTAGCGTCCACGCGAAGCAAACCCCCCAAAACCCTAGCTCCGCCGCCGTCGGCGGCGCCCGAGCTGCAACCCCCGCCACGACGCCATCCGGGTGGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 2.30% 0.44% 0.21% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 91.30% 6.70% 1.26% 0.66% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 4.70% 2.09% 1.30% NA
Tropical Japonica  504 95.60% 4.20% 0.20% 0.00% NA
Japonica Intermediate  241 80.50% 18.70% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503312521 C -> DEL N N silent_mutation Average:91.415; most accessible tissue: Zhenshan97 panicle, score: 95.381 N N N N
vg0503312521 C -> A LOC_Os05g06450.1 5_prime_UTR_variant ; 153.0bp to feature; MODIFIER silent_mutation Average:91.415; most accessible tissue: Zhenshan97 panicle, score: 95.381 N N N N
vg0503312521 C -> A LOC_Os05g06450.2 5_prime_UTR_variant ; 153.0bp to feature; MODIFIER silent_mutation Average:91.415; most accessible tissue: Zhenshan97 panicle, score: 95.381 N N N N
vg0503312521 C -> A LOC_Os05g06440.1 downstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:91.415; most accessible tissue: Zhenshan97 panicle, score: 95.381 N N N N
vg0503312521 C -> A LOC_Os05g06460.1 downstream_gene_variant ; 870.0bp to feature; MODIFIER silent_mutation Average:91.415; most accessible tissue: Zhenshan97 panicle, score: 95.381 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0503312521 C A -0.04 -0.05 -0.05 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503312521 NA 6.08E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 NA 2.18E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 NA 3.04E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 NA 3.59E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 NA 1.85E-07 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 2.40E-06 8.31E-10 mr1071_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 4.25E-06 5.03E-09 mr1080_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 5.53E-06 6.15E-09 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 6.73E-06 4.01E-10 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 2.86E-07 1.87E-10 mr1402_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 5.92E-08 9.78E-12 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 4.35E-06 2.48E-08 mr1619_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 2.39E-08 1.29E-10 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 NA 5.40E-09 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503312521 9.74E-07 5.73E-10 mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251