\
| Variant ID: vg0503118625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3118625 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 286. )
GTAAAAAGCTTTGATCAACTGCATTGACCTTCTTTTACTCTTCAATAGTACATTCGCCATTTTTGTTCCACTAATTTATTTAAGTAACTCAAGGAGATTA[A/C]
GTGCAAAGTATATGAAAAACTCGATTATTCTTTATTCTTGCACACAATAGGATATAGAAAAAATTACTATCCTTAAAGAGGTACCTATAGGTATCACACT
AGTGTGATACCTATAGGTACCTCTTTAAGGATAGTAATTTTTTCTATATCCTATTGTGTGCAAGAATAAAGAATAATCGAGTTTTTCATATACTTTGCAC[T/G]
TAATCTCCTTGAGTTACTTAAATAAATTAGTGGAACAAAAATGGCGAATGTACTATTGAAGAGTAAAAGAAGGTCAATGCAGTTGATCAAAGCTTTTTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.90% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 86.80% | 10.80% | 2.31% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.10% | 30.60% | 6.35% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503118625 | A -> C | LOC_Os05g06200.1 | downstream_gene_variant ; 1363.0bp to feature; MODIFIER | silent_mutation | Average:32.301; most accessible tissue: Callus, score: 47.077 | N | N | N | N |
| vg0503118625 | A -> C | LOC_Os05g06190-LOC_Os05g06200 | intergenic_region ; MODIFIER | silent_mutation | Average:32.301; most accessible tissue: Callus, score: 47.077 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503118625 | NA | 3.58E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503118625 | NA | 1.65E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503118625 | 9.97E-08 | 2.05E-10 | mr1218_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503118625 | NA | 1.52E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503118625 | NA | 7.50E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503118625 | 4.73E-06 | 4.95E-10 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |