\
| Variant ID: vg0502700156 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2700156 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )
AATAGACTTACTCCTTATAAAATTGTTGGCTTTCAGGCTAAGGTCGTGTTTAGTTTCAAAATATTTTCTTCAAACTTACAACTTTTTCGTCACATCAAAT[G/A]
TTTAGACACATGCATGGAGTATTAAATGTGGACGAAAAAAACCAATTGCACAGTTTGCATGTAAATCACGAGACAAATATTTTGAGCCTAATTATGCCAT
ATGGCATAATTAGGCTCAAAATATTTGTCTCGTGATTTACATGCAAACTGTGCAATTGGTTTTTTTCGTCCACATTTAATACTCCATGCATGTGTCTAAA[C/T]
ATTTGATGTGACGAAAAAGTTGTAAGTTTGAAGAAAATATTTTGAAACTAAACACGACCTTAGCCTGAAAGCCAACAATTTTATAAGGAGTAAGTCTATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 27.80% | 0.30% | 0.32% | NA |
| All Indica | 2759 | 55.00% | 44.00% | 0.47% | 0.54% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.00% | 23.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.60% | 43.50% | 0.50% | 0.34% | NA |
| Indica II | 465 | 46.20% | 52.30% | 0.43% | 1.08% | NA |
| Indica III | 913 | 56.20% | 43.40% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 58.40% | 40.10% | 0.89% | 0.64% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502700156 | G -> DEL | N | N | silent_mutation | Average:49.966; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0502700156 | G -> A | LOC_Os05g05420.1 | upstream_gene_variant ; 3758.0bp to feature; MODIFIER | silent_mutation | Average:49.966; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0502700156 | G -> A | LOC_Os05g05430.1 | upstream_gene_variant ; 377.0bp to feature; MODIFIER | silent_mutation | Average:49.966; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0502700156 | G -> A | LOC_Os05g05440.1 | downstream_gene_variant ; 3239.0bp to feature; MODIFIER | silent_mutation | Average:49.966; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0502700156 | G -> A | LOC_Os05g05430-LOC_Os05g05440 | intergenic_region ; MODIFIER | silent_mutation | Average:49.966; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502700156 | NA | 6.37E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502700156 | NA | 1.98E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502700156 | 7.22E-06 | NA | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502700156 | 2.59E-06 | 4.13E-06 | mr1944_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502700156 | 5.56E-06 | 2.14E-06 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |