\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502297050:

Variant ID: vg0502297050 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2297050
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGCATACATATATAGCCAGGGATTTTTTAATTTTAAAAATAAATGATTTTAAAATTTATTTTCAAGATCTGAATTTTTTGGCCACGCTAGCAGAACT[G/T]
ACGTGGCAAAACAATACTCTCACTCTACCCTAACTAGTGTGGCAAGACAAAACTGTCGCGCCCACTGTATATAGCGTGTCAGTGTTGTTTTTCCAAAACA

Reverse complement sequence

TGTTTTGGAAAAACAACACTGACACGCTATATACAGTGGGCGCGACAGTTTTGTCTTGCCACACTAGTTAGGGTAGAGTGAGAGTATTGTTTTGCCACGT[C/A]
AGTTCTGCTAGCGTGGCCAAAAAATTCAGATCTTGAAAATAAATTTTAAAATCATTTATTTTTAAAATTAAAAAATCCCTGGCTATATATGTATGCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 46.00% 1.95% 0.00% NA
All Indica  2759 30.70% 68.50% 0.83% 0.00% NA
All Japonica  1512 94.40% 5.40% 0.20% 0.00% NA
Aus  269 39.80% 59.90% 0.37% 0.00% NA
Indica I  595 0.30% 99.70% 0.00% 0.00% NA
Indica II  465 22.20% 77.80% 0.00% 0.00% NA
Indica III  913 53.30% 44.80% 1.86% 0.00% NA
Indica Intermediate  786 32.30% 66.90% 0.76% 0.00% NA
Temperate Japonica  767 95.60% 4.30% 0.13% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 14.50% 0.83% 0.00% NA
VI/Aromatic  96 22.90% 12.50% 64.58% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502297050 G -> T LOC_Os05g04810.1 downstream_gene_variant ; 1575.0bp to feature; MODIFIER silent_mutation Average:67.28; most accessible tissue: Callus, score: 93.965 N N N N
vg0502297050 G -> T LOC_Os05g04810-LOC_Os05g04820 intergenic_region ; MODIFIER silent_mutation Average:67.28; most accessible tissue: Callus, score: 93.965 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502297050 G T -0.07 -0.06 -0.05 -0.1 -0.06 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502297050 NA 5.66E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 1.88E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 3.69E-06 2.84E-08 mr1109_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 3.04E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 1.27E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 8.56E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 1.69E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 2.01E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 5.92E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 3.74E-06 5.70E-06 mr1865_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 2.63E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050 NA 7.12E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251