Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0502297050:

Variant ID: vg0502297050 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2297050
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGCATACATATATAGCCAGGGATTTTTTAATTTTAAAAATAAATGATTTTAAAATTTATTTTCAAGATCTGAATTTTTTGGCCACGCTAGCAGAACT[G/T]
ACGTGGCAAAACAATACTCTCACTCTACCCTAACTAGTGTGGCAAGACAAAACTGTCGCGCCCACTGTATATAGCGTGTCAGTGTTGTTTTTCCAAAACA

Reverse complement sequence

TGTTTTGGAAAAACAACACTGACACGCTATATACAGTGGGCGCGACAGTTTTGTCTTGCCACACTAGTTAGGGTAGAGTGAGAGTATTGTTTTGCCACGT[C/A]
AGTTCTGCTAGCGTGGCCAAAAAATTCAGATCTTGAAAATAAATTTTAAAATCATTTATTTTTAAAATTAAAAAATCCCTGGCTATATATGTATGCCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	46.00%	1.95%	0.00%	NA
All Indica	2759	30.70%	68.50%	0.83%	0.00%	NA
All Japonica	1512	94.40%	5.40%	0.20%	0.00%	NA
Aus	269	39.80%	59.90%	0.37%	0.00%	NA
Indica I	595	0.30%	99.70%	0.00%	0.00%	NA
Indica II	465	22.20%	77.80%	0.00%	0.00%	NA
Indica III	913	53.30%	44.80%	1.86%	0.00%	NA
Indica Intermediate	786	32.30%	66.90%	0.76%	0.00%	NA
Temperate Japonica	767	95.60%	4.30%	0.13%	0.00%	NA
Tropical Japonica	504	97.40%	2.60%	0.00%	0.00%	NA
Japonica Intermediate	241	84.60%	14.50%	0.83%	0.00%	NA
VI/Aromatic	96	22.90%	12.50%	64.58%	0.00%	NA
Intermediate	90	63.30%	33.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502297050	G -> T	LOC_Os05g04810.1	downstream_gene_variant ; 1575.0bp to feature; MODIFIER	silent_mutation	Average:67.28; most accessible tissue: Callus, score: 93.965	N	N	N	N
vg0502297050	G -> T	LOC_Os05g04810-LOC_Os05g04820	intergenic_region ; MODIFIER	silent_mutation	Average:67.28; most accessible tissue: Callus, score: 93.965	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0502297050	G	T	-0.07	-0.06	-0.05	-0.1	-0.06	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502297050	NA	5.66E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	1.88E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	3.69E-06	2.84E-08	mr1109_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	3.04E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	1.27E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	8.56E-08	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	1.69E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	2.01E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	5.92E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	3.74E-06	5.70E-06	mr1865_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	2.63E-07	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502297050	NA	7.12E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251