\
| Variant ID: vg0502283394 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2283394 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.07, others allele: 0.00, population size: 59. )
CACTGACCAAGACCAAACCCGTCAAAGGTGAGGGTTTGGGCCCGTCAGAGATGACCTGGTCCGGCGTAGTTAAATACTTTCTCCGTTTCATAATGTAAGT[C/A]
TTTCTAGTATTGTCCATATTCATATAGATGTTAATGAATCTAGATACATTCATATAAATGTTAATGAATATAAATATAACATATATATTTATATTCATTA
TAATGAATATAAATATATATGTTATATTTATATTCATTAACATTTATATGAATGTATCTAGATTCATTAACATCTATATGAATATGGACAATACTAGAAA[G/T]
ACTTACATTATGAAACGGAGAAAGTATTTAACTACGCCGGACCAGGTCATCTCTGACGGGCCCAAACCCTCACCTTTGACGGGTTTGGTCTTGGTCAGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.40% | 2.10% | 8.13% | 44.33% | NA |
| All Indica | 2759 | 30.20% | 2.70% | 9.28% | 57.77% | NA |
| All Japonica | 1512 | 71.70% | 0.70% | 6.22% | 21.36% | NA |
| Aus | 269 | 38.30% | 4.80% | 6.32% | 50.56% | NA |
| Indica I | 595 | 0.30% | 2.90% | 10.59% | 86.22% | NA |
| Indica II | 465 | 20.60% | 4.10% | 7.96% | 67.31% | NA |
| Indica III | 913 | 54.70% | 2.00% | 9.31% | 34.06% | NA |
| Indica Intermediate | 786 | 30.20% | 2.70% | 9.03% | 58.14% | NA |
| Temperate Japonica | 767 | 93.50% | 0.40% | 0.91% | 5.22% | NA |
| Tropical Japonica | 504 | 38.30% | 1.60% | 15.48% | 44.64% | NA |
| Japonica Intermediate | 241 | 72.20% | 0.00% | 3.73% | 24.07% | NA |
| VI/Aromatic | 96 | 86.50% | 2.10% | 4.17% | 7.29% | NA |
| Intermediate | 90 | 46.70% | 0.00% | 14.44% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502283394 | C -> DEL | N | N | silent_mutation | Average:15.904; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg0502283394 | C -> A | LOC_Os05g04790.1 | downstream_gene_variant ; 3346.0bp to feature; MODIFIER | silent_mutation | Average:15.904; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg0502283394 | C -> A | LOC_Os05g04790-LOC_Os05g04810 | intergenic_region ; MODIFIER | silent_mutation | Average:15.904; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502283394 | NA | 6.11E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 9.54E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | 3.83E-06 | 3.69E-06 | mr1109_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 9.78E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 4.49E-08 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 3.81E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 5.42E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 3.33E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 1.95E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 3.44E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 3.25E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502283394 | NA | 6.50E-06 | mr1957_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |