\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502198452:

Variant ID: vg0502198452 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2198452
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTTTAAAAAAATTATAGGAAAGTTACTTTAAAAAATCATATTAATATATTTTTTTAATGGTTTAGTTAATACTTAATTAATCGTGTGTTAAGGCAT[G/A]
TATCGTTTTGCGTACGAAAGAGGAGGGTTCCGAACCCCTCCTTCCCTCCTGAACACAACTTCAGTAGGTAGAAAAACTATAATGGATGGTTTGTGATTGA

Reverse complement sequence

TCAATCACAAACCATCCATTATAGTTTTTCTACCTACTGAAGTTGTGTTCAGGAGGGAAGGAGGGGTTCGGAACCCTCCTCTTTCGTACGCAAAACGATA[C/T]
ATGCCTTAACACACGATTAATTAAGTATTAACTAAACCATTAAAAAAATATATTAATATGATTTTTTAAAGTAACTTTCCTATAATTTTTTTAAAAAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.80% 0.04% 0.00% NA
All Indica  2759 77.60% 22.30% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 72.90% 27.10% 0.00% 0.00% NA
Indica II  465 83.70% 16.10% 0.22% 0.00% NA
Indica III  913 74.20% 25.80% 0.00% 0.00% NA
Indica Intermediate  786 81.60% 18.30% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502198452 G -> A LOC_Os05g04660.1 upstream_gene_variant ; 509.0bp to feature; MODIFIER silent_mutation Average:42.03; most accessible tissue: Callus, score: 88.052 N N N N
vg0502198452 G -> A LOC_Os05g04650.1 downstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:42.03; most accessible tissue: Callus, score: 88.052 N N N N
vg0502198452 G -> A LOC_Os05g04660-LOC_Os05g04670 intergenic_region ; MODIFIER silent_mutation Average:42.03; most accessible tissue: Callus, score: 88.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502198452 NA 6.09E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 1.87E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 3.65E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 5.85E-07 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 6.54E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 3.12E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 1.64E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 2.34E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 4.44E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 2.64E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 8.86E-06 8.86E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 2.04E-06 mr1573 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 1.25E-06 mr1842 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 6.88E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502198452 NA 3.57E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251