\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502193438:

Variant ID: vg0502193438 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2193438
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AATCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTATTTCATGTGTAGGTAACTTGATGCCTCAGGAGAGTATTTGCGGTGATGGACCG[G/A]
GAGTCGGCTTGGGGACAAGACGACGTCCGTGGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGC

Reverse complement sequence

GCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACCACGGACGTCGTCTTGTCCCCAAGCCGACTC[C/T]
CGGTCCATCACCGCAAATACTCTCCTGAGGCATCAAGTTACCTACACATGAAATAAACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 17.60% 2.16% 3.39% NA
All Indica  2759 62.60% 28.00% 3.70% 5.69% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 73.10% 26.70% 0.17% 0.00% NA
Indica II  465 78.10% 17.00% 2.15% 2.80% NA
Indica III  913 44.80% 34.10% 7.78% 13.36% NA
Indica Intermediate  786 66.20% 28.50% 2.54% 2.80% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 5.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502193438 G -> DEL N N silent_mutation Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0502193438 G -> A LOC_Os05g04650.1 upstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0502193438 G -> A LOC_Os05g04660.1 downstream_gene_variant ; 2992.0bp to feature; MODIFIER silent_mutation Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0502193438 G -> A LOC_Os05g04640-LOC_Os05g04650 intergenic_region ; MODIFIER silent_mutation Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502193438 3.40E-06 1.24E-07 mr1076 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 3.07E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 6.26E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 8.22E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 5.64E-06 mr1573 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 4.02E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 5.41E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 5.66E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 7.04E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438 NA 1.57E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251