\
| Variant ID: vg0502193438 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2193438 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 97. )
AATCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTATTTCATGTGTAGGTAACTTGATGCCTCAGGAGAGTATTTGCGGTGATGGACCG[G/A]
GAGTCGGCTTGGGGACAAGACGACGTCCGTGGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGC
GCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACCACGGACGTCGTCTTGTCCCCAAGCCGACTC[C/T]
CGGTCCATCACCGCAAATACTCTCCTGAGGCATCAAGTTACCTACACATGAAATAAACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 17.60% | 2.16% | 3.39% | NA |
| All Indica | 2759 | 62.60% | 28.00% | 3.70% | 5.69% | NA |
| All Japonica | 1512 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.10% | 26.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.10% | 17.00% | 2.15% | 2.80% | NA |
| Indica III | 913 | 44.80% | 34.10% | 7.78% | 13.36% | NA |
| Indica Intermediate | 786 | 66.20% | 28.50% | 2.54% | 2.80% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 5.60% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502193438 | G -> DEL | N | N | silent_mutation | Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0502193438 | G -> A | LOC_Os05g04650.1 | upstream_gene_variant ; 1431.0bp to feature; MODIFIER | silent_mutation | Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0502193438 | G -> A | LOC_Os05g04660.1 | downstream_gene_variant ; 2992.0bp to feature; MODIFIER | silent_mutation | Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0502193438 | G -> A | LOC_Os05g04640-LOC_Os05g04650 | intergenic_region ; MODIFIER | silent_mutation | Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502193438 | 3.40E-06 | 1.24E-07 | mr1076 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 3.07E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 6.26E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 8.22E-06 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 5.64E-06 | mr1573 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 4.02E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 5.41E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 5.66E-06 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 7.04E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502193438 | NA | 1.57E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |