Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0502193438:

Variant ID: vg0502193438 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2193438
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AATCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTATTTCATGTGTAGGTAACTTGATGCCTCAGGAGAGTATTTGCGGTGATGGACCG[G/A]
GAGTCGGCTTGGGGACAAGACGACGTCCGTGGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGC

Reverse complement sequence

GCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACCACGGACGTCGTCTTGTCCCCAAGCCGACTC[C/T]
CGGTCCATCACCGCAAATACTCTCCTGAGGCATCAAGTTACCTACACATGAAATAAACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	17.60%	2.16%	3.39%	NA
All Indica	2759	62.60%	28.00%	3.70%	5.69%	NA
All Japonica	1512	98.20%	1.80%	0.00%	0.00%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	73.10%	26.70%	0.17%	0.00%	NA
Indica II	465	78.10%	17.00%	2.15%	2.80%	NA
Indica III	913	44.80%	34.10%	7.78%	13.36%	NA
Indica Intermediate	786	66.20%	28.50%	2.54%	2.80%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	5.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502193438	G -> DEL	N	N	silent_mutation	Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0502193438	G -> A	LOC_Os05g04650.1	upstream_gene_variant ; 1431.0bp to feature; MODIFIER	silent_mutation	Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0502193438	G -> A	LOC_Os05g04660.1	downstream_gene_variant ; 2992.0bp to feature; MODIFIER	silent_mutation	Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0502193438	G -> A	LOC_Os05g04640-LOC_Os05g04650	intergenic_region ; MODIFIER	silent_mutation	Average:29.939; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502193438	3.40E-06	1.24E-07	mr1076	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	3.07E-06	mr1179	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	6.26E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	8.22E-06	mr1343	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	5.64E-06	mr1573	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	4.02E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	5.41E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	5.66E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	7.04E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502193438	NA	1.57E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251