\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502125341:

Variant ID: vg0502125341 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2125341
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTGAAAATTTTATTTTTGATAGGCATATTTCAATCTAACAACCTATCATCTTAATGACTTTCTC[G/A]
GATTTAATGCATAACTCTTCATTCTTCCACACATAATTGGCTACATGGGCATTGAGAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATGACTAG

Reverse complement sequence

CTAGTCATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTCTCAATGCCCATGTAGCCAATTATGTGTGGAAGAATGAAGAGTTATGCATTAAATC[C/T]
GAGAAAGTCATTAAGATGATAGGTTGTTAGATTGAAATATGCCTATCAAAAATAAAATTTTCAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 0.10% 1.33% 54.13% NA
All Indica  2759 24.10% 0.30% 1.45% 74.23% NA
All Japonica  1512 84.50% 0.00% 0.46% 15.01% NA
Aus  269 5.20% 0.00% 4.83% 89.96% NA
Indica I  595 2.70% 0.00% 1.34% 95.97% NA
Indica II  465 18.70% 1.10% 1.51% 78.71% NA
Indica III  913 44.60% 0.00% 1.53% 53.89% NA
Indica Intermediate  786 19.60% 0.30% 1.40% 78.75% NA
Temperate Japonica  767 95.60% 0.00% 0.52% 3.91% NA
Tropical Japonica  504 71.40% 0.00% 0.40% 28.17% NA
Japonica Intermediate  241 76.80% 0.00% 0.41% 22.82% NA
VI/Aromatic  96 87.50% 0.00% 1.04% 11.46% NA
Intermediate  90 64.40% 0.00% 2.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502125341 G -> DEL N N silent_mutation Average:36.767; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0502125341 G -> A LOC_Os05g04570.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:36.767; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0502125341 G -> A LOC_Os05g04550-LOC_Os05g04570 intergenic_region ; MODIFIER silent_mutation Average:36.767; most accessible tissue: Minghui63 root, score: 72.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502125341 6.25E-09 9.08E-14 mr1032 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 8.40E-08 2.37E-07 mr1032 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 9.37E-08 NA mr1165 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 4.73E-07 1.27E-06 mr1165 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 6.85E-06 NA mr1477 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 2.96E-09 7.80E-14 mr1478 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 5.45E-08 1.53E-07 mr1478 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341 8.76E-06 NA mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251