\
| Variant ID: vg0502125341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2125341 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTGAAAATTTTATTTTTGATAGGCATATTTCAATCTAACAACCTATCATCTTAATGACTTTCTC[G/A]
GATTTAATGCATAACTCTTCATTCTTCCACACATAATTGGCTACATGGGCATTGAGAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATGACTAG
CTAGTCATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTCTCAATGCCCATGTAGCCAATTATGTGTGGAAGAATGAAGAGTTATGCATTAAATC[C/T]
GAGAAAGTCATTAAGATGATAGGTTGTTAGATTGAAATATGCCTATCAAAAATAAAATTTTCAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.40% | 0.10% | 1.33% | 54.13% | NA |
| All Indica | 2759 | 24.10% | 0.30% | 1.45% | 74.23% | NA |
| All Japonica | 1512 | 84.50% | 0.00% | 0.46% | 15.01% | NA |
| Aus | 269 | 5.20% | 0.00% | 4.83% | 89.96% | NA |
| Indica I | 595 | 2.70% | 0.00% | 1.34% | 95.97% | NA |
| Indica II | 465 | 18.70% | 1.10% | 1.51% | 78.71% | NA |
| Indica III | 913 | 44.60% | 0.00% | 1.53% | 53.89% | NA |
| Indica Intermediate | 786 | 19.60% | 0.30% | 1.40% | 78.75% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 0.52% | 3.91% | NA |
| Tropical Japonica | 504 | 71.40% | 0.00% | 0.40% | 28.17% | NA |
| Japonica Intermediate | 241 | 76.80% | 0.00% | 0.41% | 22.82% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 1.04% | 11.46% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 2.22% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502125341 | G -> DEL | N | N | silent_mutation | Average:36.767; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0502125341 | G -> A | LOC_Os05g04570.1 | downstream_gene_variant ; 3911.0bp to feature; MODIFIER | silent_mutation | Average:36.767; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0502125341 | G -> A | LOC_Os05g04550-LOC_Os05g04570 | intergenic_region ; MODIFIER | silent_mutation | Average:36.767; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502125341 | 6.25E-09 | 9.08E-14 | mr1032 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 8.40E-08 | 2.37E-07 | mr1032 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 9.37E-08 | NA | mr1165 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 4.73E-07 | 1.27E-06 | mr1165 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 6.85E-06 | NA | mr1477 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 2.96E-09 | 7.80E-14 | mr1478 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 5.45E-08 | 1.53E-07 | mr1478 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502125341 | 8.76E-06 | NA | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |