\
| Variant ID: vg0501932429 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1932429 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTTATAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAA[T/C]
GGTGTCAAACATTTCAAAATAGATGGAGTACAAATCAATCAAACTATCAAAGCCAGGTTTCAAATCTCCAGCATATATAGCTGCCGCTATATTCGAAGAT
ATCTTCGAATATAGCGGCAGCTATATATGCTGGAGATTTGAAACCTGGCTTTGATAGTTTGATTGATTTGTACTCCATCTATTTTGAAATGTTTGACACC[A/G]
TTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTATAAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.60% | 13.00% | 0.19% | 16.14% | NA |
| All Indica | 2759 | 98.50% | 0.70% | 0.04% | 0.80% | NA |
| All Japonica | 1512 | 18.40% | 38.10% | 0.53% | 42.99% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.20% | 0.00% | 1.08% | NA |
| Indica III | 913 | 99.10% | 0.20% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 98.20% | 0.40% | 0.00% | 1.40% | NA |
| Temperate Japonica | 767 | 6.90% | 68.40% | 0.52% | 24.12% | NA |
| Tropical Japonica | 504 | 31.20% | 3.80% | 0.79% | 64.29% | NA |
| Japonica Intermediate | 241 | 28.20% | 13.30% | 0.00% | 58.51% | NA |
| VI/Aromatic | 96 | 22.90% | 0.00% | 0.00% | 77.08% | NA |
| Intermediate | 90 | 58.90% | 22.20% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501932429 | T -> DEL | N | N | silent_mutation | Average:33.146; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0501932429 | T -> C | LOC_Os05g04250.1 | downstream_gene_variant ; 3669.0bp to feature; MODIFIER | silent_mutation | Average:33.146; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0501932429 | T -> C | LOC_Os05g04240.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.146; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501932429 | NA | 1.78E-20 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 3.54E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 8.02E-21 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 3.77E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 2.84E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | 2.80E-06 | 3.51E-16 | mr1667 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 2.69E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 9.35E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 6.65E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 1.40E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 5.89E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501932429 | NA | 8.48E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |