\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501932429:

Variant ID: vg0501932429 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1932429
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTTATAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAA[T/C]
GGTGTCAAACATTTCAAAATAGATGGAGTACAAATCAATCAAACTATCAAAGCCAGGTTTCAAATCTCCAGCATATATAGCTGCCGCTATATTCGAAGAT

Reverse complement sequence

ATCTTCGAATATAGCGGCAGCTATATATGCTGGAGATTTGAAACCTGGCTTTGATAGTTTGATTGATTTGTACTCCATCTATTTTGAAATGTTTGACACC[A/G]
TTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTATAAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 13.00% 0.19% 16.14% NA
All Indica  2759 98.50% 0.70% 0.04% 0.80% NA
All Japonica  1512 18.40% 38.10% 0.53% 42.99% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 96.80% 2.20% 0.00% 1.08% NA
Indica III  913 99.10% 0.20% 0.00% 0.66% NA
Indica Intermediate  786 98.20% 0.40% 0.00% 1.40% NA
Temperate Japonica  767 6.90% 68.40% 0.52% 24.12% NA
Tropical Japonica  504 31.20% 3.80% 0.79% 64.29% NA
Japonica Intermediate  241 28.20% 13.30% 0.00% 58.51% NA
VI/Aromatic  96 22.90% 0.00% 0.00% 77.08% NA
Intermediate  90 58.90% 22.20% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501932429 T -> DEL N N silent_mutation Average:33.146; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0501932429 T -> C LOC_Os05g04250.1 downstream_gene_variant ; 3669.0bp to feature; MODIFIER silent_mutation Average:33.146; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0501932429 T -> C LOC_Os05g04240.1 intron_variant ; MODIFIER silent_mutation Average:33.146; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501932429 NA 1.78E-20 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 3.54E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 8.02E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 3.77E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 2.84E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 2.80E-06 3.51E-16 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 2.69E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 9.35E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 6.65E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 1.40E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 5.89E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501932429 NA 8.48E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251