\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501810272:

Variant ID: vg0501810272 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1810272
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCTTGAAAAATAGATTTATTTGATTTTTTTAAACAACTTCTATATAGATTTTTTTTAAAAAAAATACAACGTTTAGCAGTTTAAAAAACGTGCTAAC[G/A]
AAAAACGAGTAAGTTGAAATTTGGAGTTTTGCAAATAGAATGGGGCCTTATGGTGTAATTGTTTTTTATTTTCTCATTTTATGGATCAATTTGAAATTTA

Reverse complement sequence

TAAATTTCAAATTGATCCATAAAATGAGAAAATAAAAAACAATTACACCATAAGGCCCCATTCTATTTGCAAAACTCCAAATTTCAACTTACTCGTTTTT[C/T]
GTTAGCACGTTTTTTAAACTGCTAAACGTTGTATTTTTTTTAAAAAAAATCTATATAGAAGTTGTTTAAAAAAATCAAATAAATCTATTTTTCAAGCTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.20% 0.49% 0.25% NA
All Indica  2759 32.90% 66.10% 0.54% 0.43% NA
All Japonica  1512 97.40% 2.30% 0.33% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 2.20% 97.60% 0.17% 0.00% NA
Indica II  465 31.20% 68.00% 0.22% 0.65% NA
Indica III  913 55.60% 42.80% 0.55% 0.99% NA
Indica Intermediate  786 30.90% 68.10% 1.02% 0.00% NA
Temperate Japonica  767 99.00% 0.90% 0.13% 0.00% NA
Tropical Japonica  504 95.40% 4.40% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 2.50% 1.24% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 75.60% 21.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501810272 G -> DEL N N silent_mutation Average:20.405; most accessible tissue: Callus, score: 49.739 N N N N
vg0501810272 G -> A LOC_Os05g04030.1 upstream_gene_variant ; 4008.0bp to feature; MODIFIER silent_mutation Average:20.405; most accessible tissue: Callus, score: 49.739 N N N N
vg0501810272 G -> A LOC_Os05g04020.1 intron_variant ; MODIFIER silent_mutation Average:20.405; most accessible tissue: Callus, score: 49.739 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501810272 NA 9.97E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 8.00E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 4.90E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 6.89E-07 2.10E-07 mr1030_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 2.30E-06 2.06E-06 mr1030_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 5.45E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 3.47E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 2.96E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 8.05E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 1.15E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 3.61E-06 8.88E-17 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 5.46E-06 1.16E-09 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 2.68E-06 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 2.76E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 5.24E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 1.73E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 1.00E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 NA 1.00E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 6.92E-06 NA mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 1.93E-06 1.52E-08 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501810272 6.80E-06 NA mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251