\
| Variant ID: vg0501807498 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1807498 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGACATATAAAAATTATTAATAAAACACCAAATATAATCCTAATGATGATTAAAAGGAGGGACGACAAGCAGGCCGTGAAGTAAACGAGCAAGGCGGTTA[C/T]
CGGGACTTTTAGAAAGTAAAAAAAAATAAACCTCATTGATAATCATATTCGATTTTTAAAATCTCAATGACAATAAAAAGGAGAAGCAGCGGGCGGGGTG
CACCCCGCCCGCTGCTTCTCCTTTTTATTGTCATTGAGATTTTAAAAATCGAATATGATTATCAATGAGGTTTATTTTTTTTTACTTTCTAAAAGTCCCG[G/A]
TAACCGCCTTGCTCGTTTACTTCACGGCCTGCTTGTCGTCCCTCCTTTTAATCATCATTAGGATTATATTTGGTGTTTTATTAATAATTTTTATATGTCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.60% | 24.80% | 2.84% | 34.72% | NA |
| All Indica | 2759 | 61.80% | 11.50% | 2.90% | 23.89% | NA |
| All Japonica | 1512 | 1.70% | 48.50% | 2.25% | 47.55% | NA |
| Aus | 269 | 8.20% | 4.10% | 4.46% | 83.27% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 66.00% | 12.50% | 1.08% | 20.43% | NA |
| Indica III | 913 | 32.50% | 17.50% | 7.34% | 42.61% | NA |
| Indica Intermediate | 786 | 65.90% | 10.80% | 1.02% | 22.26% | NA |
| Temperate Japonica | 767 | 1.00% | 73.00% | 0.78% | 25.16% | NA |
| Tropical Japonica | 504 | 1.60% | 22.60% | 1.98% | 73.81% | NA |
| Japonica Intermediate | 241 | 3.70% | 24.90% | 7.47% | 63.90% | NA |
| VI/Aromatic | 96 | 3.10% | 87.50% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 25.60% | 32.20% | 6.67% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501807498 | C -> T | LOC_Os05g04020.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.11; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0501807498 | C -> DEL | N | N | silent_mutation | Average:17.11; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501807498 | NA | 2.82E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 3.77E-16 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 7.53E-07 | 2.25E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 2.35E-06 | 3.26E-06 | mr1030_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 8.12E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 1.31E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 6.25E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 2.83E-07 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 8.53E-06 | 1.90E-16 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 8.44E-06 | 1.59E-09 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 3.02E-06 | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 1.27E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 1.16E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 2.23E-10 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 2.23E-10 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 5.19E-06 | NA | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 2.36E-06 | 2.53E-08 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | NA | 9.78E-06 | mr1957_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 2.09E-06 | NA | mr1965_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807498 | 5.73E-06 | 5.73E-06 | mr1965_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |