\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501560528:

Variant ID: vg0501560528 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1560528
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.03, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGTCCCGCGCGGTCACGCAGGCCTGCCCTGCGGCATCGACCCGTGTGTGTGCATACATGCGTATATGCATGCATGTGCAGCGGGCTGCTCGGTCACGC[G/C]
TGGCCGGCCTGCGTGACCGCGCAGTGCCGTGCTGCTGGTCCGCGAGACCGACGCGGTGGTTGCGTCCCCCCGTGTGCCACCACGATACCGCTCTCCCGGG

Reverse complement sequence

CCCGGGAGAGCGGTATCGTGGTGGCACACGGGGGGACGCAACCACCGCGTCGGTCTCGCGGACCAGCAGCACGGCACTGCGCGGTCACGCAGGCCGGCCA[C/G]
GCGTGACCGAGCAGCCCGCTGCACATGCATGCATATACGCATGTATGCACACACACGGGTCGATGCCGCAGGGCAGGCCTGCGTGACCGCGCGGGACTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 36.00% 1.33% 3.51% NA
All Indica  2759 89.10% 3.00% 1.99% 5.91% NA
All Japonica  1512 2.90% 96.90% 0.07% 0.13% NA
Aus  269 92.60% 5.20% 2.23% 0.00% NA
Indica I  595 87.40% 1.20% 2.86% 8.57% NA
Indica II  465 89.90% 4.10% 0.65% 5.38% NA
Indica III  913 90.40% 2.70% 1.64% 5.26% NA
Indica Intermediate  786 88.40% 4.10% 2.54% 4.96% NA
Temperate Japonica  767 1.20% 98.70% 0.13% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 95.90% 0.00% 0.83% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 36.70% 61.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501560528 G -> DEL N N silent_mutation Average:77.181; most accessible tissue: Minghui63 panicle, score: 98.788 N N N N
vg0501560528 G -> C LOC_Os05g03630.1 downstream_gene_variant ; 3277.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 panicle, score: 98.788 N N N N
vg0501560528 G -> C LOC_Os05g03640.1 downstream_gene_variant ; 1452.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 panicle, score: 98.788 N N N N
vg0501560528 G -> C LOC_Os05g03630-LOC_Os05g03640 intergenic_region ; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 panicle, score: 98.788 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501560528 G C -0.03 -0.05 0.0 -0.03 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501560528 NA 1.62E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 1.69E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 3.07E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 6.26E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 7.17E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 1.16E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 2.20E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 4.01E-83 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 4.47E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 3.32E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 3.75E-60 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 5.23E-76 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 7.03E-64 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 3.52E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 8.61E-85 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 1.89E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 9.36E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 2.88E-120 mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 1.27E-52 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 1.47E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 4.18E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 3.86E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 3.74E-49 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 5.75E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 5.75E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 9.13E-62 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 7.79E-22 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501560528 NA 1.95E-96 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251