\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501552250:

Variant ID: vg0501552250 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 1552250
Reference Allele: CAlternative Allele: T,CT,CA,A,CAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGATTTTTGGACTGGGCTGATGATGTTCAAGGCCTACAGATGACTGTGCCCAGTGGGCCATTTGGGTCCATGTTGTATAGGGCCTGTTCACTTTGATG[C/T,CT,CA,A,CAA]
CAAAAAAACCATACCAAATTTTAGCATTGCCGAAATTTTGGTAACTGTGTCAAAATTTTGGCAGGCAGGATTTCTTATATAGTTACCAAAATTTGGCAGC

Reverse complement sequence

GCTGCCAAATTTTGGTAACTATATAAGAAATCCTGCCTGCCAAAATTTTGACACAGTTACCAAAATTTCGGCAATGCTAAAATTTGGTATGGTTTTTTTG[G/A,AG,TG,T,TTG]
CATCAAAGTGAACAGGCCCTATACAACATGGACCCAAATGGCCCACTGGGCACAGTCATCTGTAGGCCTTGAACATCATCAGCCCAGTCCAAAAATCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 1.00% 12.59% 45.15% CT: 0.06%; A: 0.04%; CAA: 0.04%; CA: 0.02%
All Indica  2759 4.90% 1.70% 17.51% 75.86% CAA: 0.07%
All Japonica  1512 97.20% 0.00% 1.79% 0.99% CA: 0.07%
Aus  269 97.00% 0.00% 0.74% 1.12% CT: 1.12%
Indica I  595 3.70% 1.00% 4.54% 90.76% NA
Indica II  465 7.10% 1.30% 21.29% 70.32% NA
Indica III  913 3.50% 1.60% 26.62% 68.13% CAA: 0.11%
Indica Intermediate  786 6.00% 2.50% 14.50% 76.84% CAA: 0.13%
Temperate Japonica  767 98.80% 0.00% 0.39% 0.65% CA: 0.13%
Tropical Japonica  504 94.80% 0.00% 3.97% 1.19% NA
Japonica Intermediate  241 96.70% 0.00% 1.66% 1.66% NA
VI/Aromatic  96 21.90% 1.00% 77.08% 0.00% NA
Intermediate  90 62.20% 0.00% 10.00% 25.56% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501552250 C -> DEL N N silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> T LOC_Os05g03630.1 upstream_gene_variant ; 1183.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> T LOC_Os05g03620.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> T LOC_Os05g03620-LOC_Os05g03630 intergenic_region ; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CA LOC_Os05g03630.1 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CA LOC_Os05g03620.1 downstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CA LOC_Os05g03620-LOC_Os05g03630 intergenic_region ; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CT LOC_Os05g03630.1 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CT LOC_Os05g03620.1 downstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CT LOC_Os05g03620-LOC_Os05g03630 intergenic_region ; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> A LOC_Os05g03630.1 upstream_gene_variant ; 1183.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> A LOC_Os05g03620.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> A LOC_Os05g03620-LOC_Os05g03630 intergenic_region ; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CAA LOC_Os05g03630.1 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CAA LOC_Os05g03620.1 downstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N
vg0501552250 C -> CAA LOC_Os05g03620-LOC_Os05g03630 intergenic_region ; MODIFIER silent_mutation Average:77.065; most accessible tissue: Callus, score: 96.52 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501552250 C A 0.01 0.0 0.0 -0.01 0.0 0.01
vg0501552250 C CA 0.02 0.03 0.13 0.04 0.08 0.07
vg0501552250 C CAA -0.07 0.0 0.23 -0.01 0.03 -0.01
vg0501552250 C CT 0.04 0.04 0.13 0.05 0.09 0.09
vg0501552250 C T 0.0 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501552250 NA 1.57E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.66E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.86E-49 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.45E-36 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.70E-53 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 5.47E-45 mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.47E-46 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 4.16E-35 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.37E-47 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 8.89E-48 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.27E-54 mr1121 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.87E-44 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 5.96E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.62E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.12E-41 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.86E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 5.31E-45 mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.74E-29 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 9.62E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.04E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.29E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.24E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 7.68E-59 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.47E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.54E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 4.22E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.08E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.19E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 4.43E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.09E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 5.81E-68 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.09E-83 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 5.18E-32 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.64E-63 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.25E-48 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.52E-47 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.72E-64 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.57E-58 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.67E-55 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.63E-39 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 9.78E-52 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.10E-66 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.22E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.14E-57 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 5.23E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.79E-54 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.71E-58 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.20E-24 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 3.19E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 9.34E-48 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 8.11E-50 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.16E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 2.11E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.59E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 6.45E-31 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 4.90E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 4.90E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 1.66E-68 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501552250 NA 7.83E-104 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251