| Variant ID: vg0501245532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1245532 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 108. )
TTTTTTTTTCGTTTCTTTTTTACCTTTTTCCCCTTTTCCTTTCTTTTTTCTGATTTTTTTTATCTTTAGCATCTTTTGAGTTTGAAAGTTTTTAAATTTT[G/A]
AGTTGAAAATTAAAAATCTGATCTTAAAAGTTTTCAAATCTCGACTTGAAAGTTTTCAAATCTAAAATTGAAAGTTTTCAACTTTTTAAAATCTGAAGTT
AACTTCAGATTTTAAAAAGTTGAAAACTTTCAATTTTAGATTTGAAAACTTTCAAGTCGAGATTTGAAAACTTTTAAGATCAGATTTTTAATTTTCAACT[C/T]
AAAATTTAAAAACTTTCAAACTCAAAAGATGCTAAAGATAAAAAAAATCAGAAAAAAGAAAGGAAAAGGGGAAAAAGGTAAAAAAGAAACGAAAAAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 29.30% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 52.20% | 47.30% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 26.40% | 73.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 38.70% | 60.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 81.60% | 17.60% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 45.70% | 54.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501245532 | G -> A | LOC_Os05g03120.1 | downstream_gene_variant ; 179.0bp to feature; MODIFIER | silent_mutation | Average:32.442; most accessible tissue: Callus, score: 85.907 | N | N | N | N |
| vg0501245532 | G -> A | LOC_Os05g03130.1 | downstream_gene_variant ; 754.0bp to feature; MODIFIER | silent_mutation | Average:32.442; most accessible tissue: Callus, score: 85.907 | N | N | N | N |
| vg0501245532 | G -> A | LOC_Os05g03120.2 | downstream_gene_variant ; 212.0bp to feature; MODIFIER | silent_mutation | Average:32.442; most accessible tissue: Callus, score: 85.907 | N | N | N | N |
| vg0501245532 | G -> A | LOC_Os05g03120.3 | downstream_gene_variant ; 179.0bp to feature; MODIFIER | silent_mutation | Average:32.442; most accessible tissue: Callus, score: 85.907 | N | N | N | N |
| vg0501245532 | G -> A | LOC_Os05g03120-LOC_Os05g03130 | intergenic_region ; MODIFIER | silent_mutation | Average:32.442; most accessible tissue: Callus, score: 85.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501245532 | NA | 2.26E-06 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 7.50E-06 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 4.99E-06 | mr1434 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 1.40E-07 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 5.67E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 2.21E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 1.54E-19 | mr1807 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245532 | NA | 2.87E-07 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |