Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0501245532:

Variant ID: vg0501245532 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1245532
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTTTCGTTTCTTTTTTACCTTTTTCCCCTTTTCCTTTCTTTTTTCTGATTTTTTTTATCTTTAGCATCTTTTGAGTTTGAAAGTTTTTAAATTTT[G/A]
AGTTGAAAATTAAAAATCTGATCTTAAAAGTTTTCAAATCTCGACTTGAAAGTTTTCAAATCTAAAATTGAAAGTTTTCAACTTTTTAAAATCTGAAGTT

Reverse complement sequence

AACTTCAGATTTTAAAAAGTTGAAAACTTTCAATTTTAGATTTGAAAACTTTCAAGTCGAGATTTGAAAACTTTTAAGATCAGATTTTTAATTTTCAACT[C/T]
AAAATTTAAAAACTTTCAAACTCAAAAGATGCTAAAGATAAAAAAAATCAGAAAAAAGAAAGGAAAAGGGGAAAAAGGTAAAAAAGAAACGAAAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	29.30%	0.32%	0.00%	NA
All Indica	2759	52.20%	47.30%	0.43%	0.00%	NA
All Japonica	1512	98.90%	1.00%	0.07%	0.00%	NA
Aus	269	96.30%	3.00%	0.74%	0.00%	NA
Indica I	595	26.40%	73.40%	0.17%	0.00%	NA
Indica II	465	38.70%	60.90%	0.43%	0.00%	NA
Indica III	913	81.60%	17.60%	0.77%	0.00%	NA
Indica Intermediate	786	45.70%	54.10%	0.25%	0.00%	NA
Temperate Japonica	767	99.00%	0.90%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	61.50%	38.50%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501245532	G -> A	LOC_Os05g03120.1	downstream_gene_variant ; 179.0bp to feature; MODIFIER	silent_mutation	Average:32.442; most accessible tissue: Callus, score: 85.907	N	N	N	N
vg0501245532	G -> A	LOC_Os05g03130.1	downstream_gene_variant ; 754.0bp to feature; MODIFIER	silent_mutation	Average:32.442; most accessible tissue: Callus, score: 85.907	N	N	N	N
vg0501245532	G -> A	LOC_Os05g03120.2	downstream_gene_variant ; 212.0bp to feature; MODIFIER	silent_mutation	Average:32.442; most accessible tissue: Callus, score: 85.907	N	N	N	N
vg0501245532	G -> A	LOC_Os05g03120.3	downstream_gene_variant ; 179.0bp to feature; MODIFIER	silent_mutation	Average:32.442; most accessible tissue: Callus, score: 85.907	N	N	N	N
vg0501245532	G -> A	LOC_Os05g03120-LOC_Os05g03130	intergenic_region ; MODIFIER	silent_mutation	Average:32.442; most accessible tissue: Callus, score: 85.907	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501245532	NA	2.26E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	7.50E-06	mr1318	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	4.99E-06	mr1434	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	1.40E-07	mr1510	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	5.67E-06	mr1624	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	2.21E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	1.54E-19	mr1807	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532	NA	2.87E-07	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251