\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501245532:

Variant ID: vg0501245532 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1245532
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTTCGTTTCTTTTTTACCTTTTTCCCCTTTTCCTTTCTTTTTTCTGATTTTTTTTATCTTTAGCATCTTTTGAGTTTGAAAGTTTTTAAATTTT[G/A]
AGTTGAAAATTAAAAATCTGATCTTAAAAGTTTTCAAATCTCGACTTGAAAGTTTTCAAATCTAAAATTGAAAGTTTTCAACTTTTTAAAATCTGAAGTT

Reverse complement sequence

AACTTCAGATTTTAAAAAGTTGAAAACTTTCAATTTTAGATTTGAAAACTTTCAAGTCGAGATTTGAAAACTTTTAAGATCAGATTTTTAATTTTCAACT[C/T]
AAAATTTAAAAACTTTCAAACTCAAAAGATGCTAAAGATAAAAAAAATCAGAAAAAAGAAAGGAAAAGGGGAAAAAGGTAAAAAAGAAACGAAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.30% 0.32% 0.00% NA
All Indica  2759 52.20% 47.30% 0.43% 0.00% NA
All Japonica  1512 98.90% 1.00% 0.07% 0.00% NA
Aus  269 96.30% 3.00% 0.74% 0.00% NA
Indica I  595 26.40% 73.40% 0.17% 0.00% NA
Indica II  465 38.70% 60.90% 0.43% 0.00% NA
Indica III  913 81.60% 17.60% 0.77% 0.00% NA
Indica Intermediate  786 45.70% 54.10% 0.25% 0.00% NA
Temperate Japonica  767 99.00% 0.90% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501245532 G -> A LOC_Os05g03120.1 downstream_gene_variant ; 179.0bp to feature; MODIFIER silent_mutation Average:32.442; most accessible tissue: Callus, score: 85.907 N N N N
vg0501245532 G -> A LOC_Os05g03130.1 downstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:32.442; most accessible tissue: Callus, score: 85.907 N N N N
vg0501245532 G -> A LOC_Os05g03120.2 downstream_gene_variant ; 212.0bp to feature; MODIFIER silent_mutation Average:32.442; most accessible tissue: Callus, score: 85.907 N N N N
vg0501245532 G -> A LOC_Os05g03120.3 downstream_gene_variant ; 179.0bp to feature; MODIFIER silent_mutation Average:32.442; most accessible tissue: Callus, score: 85.907 N N N N
vg0501245532 G -> A LOC_Os05g03120-LOC_Os05g03130 intergenic_region ; MODIFIER silent_mutation Average:32.442; most accessible tissue: Callus, score: 85.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501245532 NA 2.26E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 7.50E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 4.99E-06 mr1434 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 1.40E-07 mr1510 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 5.67E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 2.21E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 1.54E-19 mr1807 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245532 NA 2.87E-07 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251