\
| Variant ID: vg0501218823 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1218823 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 119. )
AAATTACAAGCATAATTTTTTACTTTTAATTATTCTTCTAATTATTCTTATAATTACCTGGTAATTGCTTCATTGTCTTAAATCTCTGTGCTTTTTTGTC[G/A]
GTATCTGTTTCAAAACCTTTCGAAACCAAAATTTTTTATTTTTTGATCAAGATTAGTGAAAAAAAAGTACTTAATATGAAATTTACATAGCAATACACTT
AAGTGTATTGCTATGTAAATTTCATATTAAGTACTTTTTTTTCACTAATCTTGATCAAAAAATAAAAAATTTTGGTTTCGAAAGGTTTTGAAACAGATAC[C/T]
GACAAAAAAGCACAGAGATTTAAGACAATGAAGCAATTACCAGGTAATTATAAGAATAATTAGAAGAATAATTAAAAGTAAAAAATTATGCTTGTAATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 14.10% | 5.48% | 0.00% | NA |
| All Indica | 2759 | 67.00% | 23.80% | 9.21% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 33.30% | 47.40% | 19.33% | 0.00% | NA |
| Indica II | 465 | 61.70% | 29.70% | 8.60% | 0.00% | NA |
| Indica III | 913 | 95.50% | 2.60% | 1.86% | 0.00% | NA |
| Indica Intermediate | 786 | 62.60% | 27.00% | 10.43% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501218823 | G -> A | LOC_Os05g03090.1 | synonymous_variant ; p.Thr105Thr; LOW | synonymous_codon | Average:10.301; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501218823 | NA | 6.42E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 1.87E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 5.41E-06 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 4.75E-07 | mr1434 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 6.60E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 9.08E-06 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 1.09E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 4.28E-06 | mr1630 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 5.29E-09 | mr1691 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 1.25E-07 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 4.81E-06 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 6.11E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 6.32E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 7.50E-17 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 2.52E-07 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501218823 | NA | 5.08E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |