\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501188064:

Variant ID: vg0501188064 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1188064
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTATATATCTGAAACTTATACACATTATATAGAAAATACTGCAATACATTAAAGTTTACCTCTCATAGCTCATTGTATAGATGTATTTAAAGGCCCA[C/G]
TAAAATCCATACATTTCAGAATATCTTAGAAGTTTAATTTTTCAAATCTGCTAAAAAATAAATATGGGAGTAACATTTATCATACATGTAGCCACATATT

Reverse complement sequence

AATATGTGGCTACATGTATGATAAATGTTACTCCCATATTTATTTTTTAGCAGATTTGAAAAATTAAACTTCTAAGATATTCTGAAATGTATGGATTTTA[G/C]
TGGGCCTTTAAATACATCTATACAATGAGCTATGAGAGGTAAACTTTAATGTATTGCAGTATTTTCTATATAATGTGTATAAGTTTCAGATATATAAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.90% 0.00% 0.00% NA
All Indica  2759 91.00% 9.00% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 24.50% 75.50% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 84.80% 15.20% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501188064 C -> G LOC_Os05g03050.1 intron_variant ; MODIFIER silent_mutation Average:30.509; most accessible tissue: Callus, score: 75.843 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501188064 NA 8.24E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 6.16E-06 3.09E-09 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 4.37E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 4.94E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 3.93E-07 mr1181_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 6.23E-08 mr1676_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 8.66E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 4.45E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501188064 NA 4.86E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251