\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501160825:

Variant ID: vg0501160825 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1160825
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CTCATCTTTTCAATTATGCTTGTACTTATCAGTTAAAATATAAATTTTAAATTTTAAATTTGGAGATGATTTTAGGGTTTTTACATTGAAGTTTATTTTT[T/C]
AGCTATTTGCTTTTAGATCGTTAAGAACATGTATATACAAATTTTATTTACAAATTAATTTTTGCTTGCAAATATATCGTTTGGCTTTGGCTTATTCCCC

Reverse complement sequence

GGGGAATAAGCCAAAGCCAAACGATATATTTGCAAGCAAAAATTAATTTGTAAATAAAATTTGTATATACATGTTCTTAACGATCTAAAAGCAAATAGCT[A/G]
AAAAATAAACTTCAATGTAAAAACCCTAAAATCATCTCCAAATTTAAAATTTAAAATTTATATTTTAACTGATAAGTACAAGCATAATTGAAAAGATGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 44.10% 0.15% 0.00% NA
All Indica  2759 42.40% 57.40% 0.11% 0.00% NA
All Japonica  1512 87.20% 12.70% 0.07% 0.00% NA
Aus  269 1.90% 97.00% 1.12% 0.00% NA
Indica I  595 26.20% 73.60% 0.17% 0.00% NA
Indica II  465 34.20% 65.60% 0.22% 0.00% NA
Indica III  913 57.10% 42.80% 0.11% 0.00% NA
Indica Intermediate  786 42.60% 57.40% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 67.10% 32.90% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501160825 T -> C LOC_Os05g03040.1 upstream_gene_variant ; 558.0bp to feature; MODIFIER silent_mutation Average:78.359; most accessible tissue: Minghui63 young leaf, score: 96.859 N N N N
vg0501160825 T -> C LOC_Os05g03040.2 upstream_gene_variant ; 1122.0bp to feature; MODIFIER silent_mutation Average:78.359; most accessible tissue: Minghui63 young leaf, score: 96.859 N N N N
vg0501160825 T -> C LOC_Os05g03040.3 upstream_gene_variant ; 620.0bp to feature; MODIFIER silent_mutation Average:78.359; most accessible tissue: Minghui63 young leaf, score: 96.859 N N N N
vg0501160825 T -> C LOC_Os05g03040-LOC_Os05g03050 intergenic_region ; MODIFIER silent_mutation Average:78.359; most accessible tissue: Minghui63 young leaf, score: 96.859 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501160825 NA 8.97E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 5.59E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 6.83E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 5.44E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 9.01E-06 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 5.10E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 7.94E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 2.61E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 1.20E-06 mr1460 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 6.12E-08 mr1510 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 6.49E-07 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 4.62E-09 mr1681 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 9.21E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 8.48E-06 8.48E-06 mr1779 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501160825 NA 1.66E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251