\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501018704:

Variant ID: vg0501018704 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1018704
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAAATAGAGTTAGAAATGTAAGGTTTTCATCATGGTGGATTTGAAAAAAATGAGAGAAAGCACCGCTGGTATTATAGTGCAGTCGTGGGTGCATGA[C/A]
TTAATCTATCAAAGATAAAAATTTTGATGTCGTCGAATACTATGTACACACGAGTGCGCTTTTGATAGAAATTCAGTGAAATCATGGATGGTTGATATCC

Reverse complement sequence

GGATATCAACCATCCATGATTTCACTGAATTTCTATCAAAAGCGCACTCGTGTGTACATAGTATTCGACGACATCAAAATTTTTATCTTTGATAGATTAA[G/T]
TCATGCACCCACGACTGCACTATAATACCAGCGGTGCTTTCTCTCATTTTTTTCAAATCCACCATGATGAAAACCTTACATTTCTAACTCTATTTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 7.00% 0.02% 0.00% NA
All Indica  2759 88.00% 11.90% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 77.40% 22.60% 0.00% 0.00% NA
Indica Intermediate  786 90.50% 9.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501018704 C -> A LOC_Os05g02820.1 upstream_gene_variant ; 1092.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0501018704 C -> A LOC_Os05g02820-LOC_Os05g02840 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501018704 NA 6.36E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501018704 NA 1.80E-08 mr1671 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501018704 NA 9.36E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501018704 NA 5.06E-07 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251